Incidental Mutation 'PIT4458001:Zdhhc16'
ID555941
Institutional Source Beutler Lab
Gene Symbol Zdhhc16
Ensembl Gene ENSMUSG00000025157
Gene Namezinc finger, DHHC domain containing 16
Synonyms1500015N03Rik, Abl-philin 2, APH2
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.577) question?
Stock #PIT4458001 (G1)
Quality Score191.009
Status Not validated
Chromosome19
Chromosomal Location41933480-41944104 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 41937770 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 55 (G55R)
Ref Sequence ENSEMBL: ENSMUSP00000026154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026154] [ENSMUST00000075280] [ENSMUST00000112123] [ENSMUST00000167927] [ENSMUST00000171561] [ENSMUST00000223802] [ENSMUST00000224258] [ENSMUST00000224562] [ENSMUST00000224896] [ENSMUST00000225968]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026154
AA Change: G55R

PolyPhen 2 Score 0.656 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000026154
Gene: ENSMUSG00000025157
AA Change: G55R

DomainStartEndE-ValueType
low complexity region 7 35 N/A INTRINSIC
transmembrane domain 81 103 N/A INTRINSIC
transmembrane domain 115 137 N/A INTRINSIC
Pfam:zf-DHHC 151 289 1e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075280
SMART Domains Protein: ENSMUSP00000074756
Gene: ENSMUSG00000034321

DomainStartEndE-ValueType
Pfam:ECR1_N 8 44 3.8e-12 PFAM
S1 66 147 3.75e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112123
SMART Domains Protein: ENSMUSP00000107751
Gene: ENSMUSG00000034321

DomainStartEndE-ValueType
Pfam:ECR1_N 7 41 3.9e-14 PFAM
Pfam:EXOSC1 64 94 7.9e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167927
SMART Domains Protein: ENSMUSP00000132483
Gene: ENSMUSG00000025159

DomainStartEndE-ValueType
Pfam:MMS19_N 51 313 4.6e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171561
SMART Domains Protein: ENSMUSP00000130900
Gene: ENSMUSG00000025159

DomainStartEndE-ValueType
Pfam:MMS19_N 51 312 6.3e-90 PFAM
low complexity region 372 386 N/A INTRINSIC
Pfam:MMS19_C 528 963 3.9e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223802
Predicted Effect possibly damaging
Transcript: ENSMUST00000224258
AA Change: G55R

PolyPhen 2 Score 0.656 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000224537
Predicted Effect probably benign
Transcript: ENSMUST00000224562
AA Change: G55R

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect possibly damaging
Transcript: ENSMUST00000224896
AA Change: G55R

PolyPhen 2 Score 0.656 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000225968
AA Change: G35R

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.8%
  • 10x: 85.3%
  • 20x: 73.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display prenatal and neonatal lethality with bradycardia, abnormal heart morphology and eye defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G T 11: 9,298,304 V2684L probably benign Het
Adamts9 T A 6: 92,889,905 I718F probably damaging Het
Adcyap1r1 A G 6: 55,478,082 D110G probably benign Het
Adgrd1 G A 5: 129,131,577 G281D probably damaging Het
Afg1l A T 10: 42,454,370 C100* probably null Het
Atp2a2 G A 5: 122,457,309 Q993* probably null Het
Baz1a A G 12: 54,930,310 M389T probably benign Het
Btnl4 T A 17: 34,474,268 M58L probably benign Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cpeb1 A T 7: 81,348,432 F533Y probably damaging Het
Ctnna1 T A 18: 35,175,126 N166K possibly damaging Het
Ecsit T C 9: 22,076,284 H153R probably damaging Het
Gbp8 T C 5: 105,015,089 K480E probably benign Het
Glyat A T 19: 12,648,009 T66S probably benign Het
Gm1110 T C 9: 26,880,828 Q632R probably benign Het
Gm12185 C T 11: 48,907,911 R585Q probably damaging Het
Gm17669 TAA TAAA 18: 67,562,749 probably null Het
Gm7489 A C 15: 53,885,799 E89A unknown Het
Grb7 C T 11: 98,453,829 Q353* probably null Het
Ifi207 G A 1: 173,735,172 T136I unknown Het
Ighv3-1 T C 12: 113,964,604 Y45C probably benign Het
Ing5 A G 1: 93,811,946 M92V possibly damaging Het
Ivl TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 3: 92,572,301 probably benign Het
Kdm6b A T 11: 69,399,952 D1630E unknown Het
Lmo7 C T 14: 101,887,487 Q583* probably null Het
Lrrc37a T C 11: 103,504,512 D29G probably benign Het
Mpdz G T 4: 81,419,026 A10D probably damaging Het
Myh4 A G 11: 67,240,995 M94V possibly damaging Het
Nectin2 A C 7: 19,738,327 L46V probably benign Het
Nynrin A T 14: 55,863,968 T365S probably benign Het
Olfr1225 A T 2: 89,170,633 I193K probably benign Het
Pde4b A C 4: 102,602,678 E570A probably damaging Het
Phf3 T C 1: 30,816,541 H988R probably damaging Het
Ppfia2 A G 10: 106,927,847 K1234E probably benign Het
Prl7c1 A T 13: 27,773,758 M233K probably benign Het
Prp2 C T 6: 132,600,547 P266S unknown Het
Ralgds T C 2: 28,542,474 L160P probably damaging Het
Rasa1 A T 13: 85,227,118 M664K possibly damaging Het
Ryr2 T C 13: 11,555,448 T4930A probably benign Het
Senp8 T C 9: 59,737,480 Y131C probably damaging Het
Sp100 A G 1: 85,708,116 I547M probably benign Het
Spata20 A G 11: 94,484,608 M120T probably damaging Het
Spata31 A G 13: 64,921,850 H604R probably benign Het
Sycp1 A T 3: 102,934,833 S53T probably benign Het
Tgm1 T C 14: 55,712,565 D62G unknown Het
Trpm1 G C 7: 64,268,561 E1434Q possibly damaging Het
Tshb A T 3: 102,778,164 Y50N probably damaging Het
Wdr17 A T 8: 54,673,579 Y413* probably null Het
Other mutations in Zdhhc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Zdhhc16 APN 19 41939660 missense probably benign 0.29
IGL01290:Zdhhc16 APN 19 41938048 splice site probably null
IGL01368:Zdhhc16 APN 19 41941506 splice site probably null
IGL02191:Zdhhc16 APN 19 41937691 nonsense probably null
FR4342:Zdhhc16 UTSW 19 41942149 intron probably benign
FR4548:Zdhhc16 UTSW 19 41942168 frame shift probably null
R1258:Zdhhc16 UTSW 19 41938044 missense possibly damaging 0.64
R1335:Zdhhc16 UTSW 19 41940634 splice site probably null
R1757:Zdhhc16 UTSW 19 41941955 missense probably damaging 1.00
R3833:Zdhhc16 UTSW 19 41938114 critical splice donor site probably null
R4381:Zdhhc16 UTSW 19 41940654 missense possibly damaging 0.63
R4615:Zdhhc16 UTSW 19 41943683 missense possibly damaging 0.74
R5789:Zdhhc16 UTSW 19 41938133 missense probably damaging 1.00
R6177:Zdhhc16 UTSW 19 41937759 missense probably benign 0.06
R7252:Zdhhc16 UTSW 19 41941551 missense probably damaging 1.00
R8458:Zdhhc16 UTSW 19 41939654 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGTATGACTCAGGCTGGATC -3'
(R):5'- TTCCAGAGCTTTGTAAGATGCC -3'

Sequencing Primer
(F):5'- AGTATACTCTCCTAGGAGCCATG -3'
(R):5'- CTTTGTAAGATGCCTCCAAAGCTCAG -3'
Posted On2019-06-07