Incidental Mutation 'PIT4495001:Intu'
ID 555949
Institutional Source Beutler Lab
Gene Symbol Intu
Ensembl Gene ENSMUSG00000060798
Gene Name inturned planar cell polarity protein
Synonyms Pdzk6, 9230116I04Rik, Pdzd6, 9430087H23Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # PIT4495001 (G1)
Quality Score 216.009
Status Not validated
Chromosome 3
Chromosomal Location 40585559-40659206 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 40652033 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 830 (Q830R)
Ref Sequence ENSEMBL: ENSMUSP00000088725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091186]
AlphaFold Q059U7
Predicted Effect probably benign
Transcript: ENSMUST00000091186
AA Change: Q830R

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000088725
Gene: ENSMUSG00000060798
AA Change: Q830R

DomainStartEndE-ValueType
low complexity region 21 48 N/A INTRINSIC
low complexity region 64 81 N/A INTRINSIC
PDZ 187 269 2.09e-3 SMART
low complexity region 459 468 N/A INTRINSIC
low complexity region 774 784 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.6%
  • 10x: 84.0%
  • 20x: 69.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice show defective ciliogenesis and neural tube closure, abnormal patterning of the CNS and limbs, polydactyly, edema and death by E16.5. Homozygotes for a hypomorphic allele show defective ciliation and endochondral ossification, stunted growth, polydactyly and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 T A 1: 156,460,755 (GRCm39) V384D probably damaging Het
Adamts7 A G 9: 90,056,675 (GRCm39) E248G probably damaging Het
Aff1 A G 5: 103,997,391 (GRCm39) T1162A probably benign Het
Ank3 C A 10: 69,828,902 (GRCm39) H2524N Het
Aoc1l3 A T 6: 48,964,710 (GRCm39) E239D possibly damaging Het
Cct7 T A 6: 85,436,943 (GRCm39) N60K probably damaging Het
Cfap43 A C 19: 47,885,741 (GRCm39) C291W probably damaging Het
Cobl G A 11: 12,204,596 (GRCm39) T702I probably benign Het
Col5a1 C A 2: 27,914,788 (GRCm39) Q1624K unknown Het
Cubn T A 2: 13,496,561 (GRCm39) T22S probably benign Het
Def8 A C 8: 124,186,292 (GRCm39) M344L probably benign Het
Fzd7 A G 1: 59,523,466 (GRCm39) T450A probably benign Het
Gm11214 G A 4: 63,580,922 (GRCm39) L76F probably benign Het
Gm5797 T C 14: 7,329,530 (GRCm38) T153A probably benign Het
Gsk3a A C 7: 24,935,064 (GRCm39) S129A probably damaging Het
Kcnma1 C T 14: 23,475,665 (GRCm39) V750I probably benign Het
Mlh1 T A 9: 111,076,328 (GRCm39) Y343F probably benign Het
Myb C T 10: 21,028,521 (GRCm39) R114H probably damaging Het
Neb A T 2: 52,102,748 (GRCm39) D4508E probably benign Het
Nell2 T C 15: 95,281,608 (GRCm39) D366G probably benign Het
Or1o3 A C 17: 37,573,721 (GRCm39) V278G possibly damaging Het
Or4d6 A G 19: 12,086,076 (GRCm39) I52T possibly damaging Het
Or5ac25 A C 16: 59,181,871 (GRCm39) F237V probably damaging Het
Or5h26 G T 16: 58,988,337 (GRCm39) H56Q possibly damaging Het
Or7a38 T C 10: 78,752,821 (GRCm39) V49A probably benign Het
Pcdhgc5 C T 18: 37,954,030 (GRCm39) H435Y possibly damaging Het
Pira12 A T 7: 3,900,457 (GRCm39) C98S probably damaging Het
Pnpla7 T A 2: 24,932,151 (GRCm39) D935E probably damaging Het
Pole A G 5: 110,451,780 (GRCm39) E874G probably damaging Het
Psd3 A C 8: 68,416,565 (GRCm39) I158R probably benign Het
Pzp C A 6: 128,479,192 (GRCm39) V654L probably benign Het
Rabep1 A G 11: 70,808,405 (GRCm39) T454A probably damaging Het
Rad54l2 C A 9: 106,593,343 (GRCm39) S419I probably benign Het
Rin3 A G 12: 102,335,295 (GRCm39) D402G probably benign Het
Ripk4 T C 16: 97,544,370 (GRCm39) H759R probably damaging Het
Rlig1 A T 10: 100,419,812 (GRCm39) F90I probably damaging Het
Sbsn GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA 7: 30,452,391 (GRCm39) probably benign Het
Sf3a3 C T 4: 124,622,113 (GRCm39) P391L probably damaging Het
Snx9 T A 17: 5,970,401 (GRCm39) I379K possibly damaging Het
Syt5 A C 7: 4,544,077 (GRCm39) probably null Het
Tex47 A G 5: 7,355,011 (GRCm39) D64G probably benign Het
Zbbx C A 3: 74,968,944 (GRCm39) W509L probably damaging Het
Zer1 T C 2: 29,993,555 (GRCm39) K551R probably benign Het
Other mutations in Intu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Intu APN 3 40,618,696 (GRCm39) missense probably benign 0.12
IGL01386:Intu APN 3 40,647,017 (GRCm39) missense probably damaging 1.00
IGL02645:Intu APN 3 40,655,702 (GRCm39) missense probably benign 0.01
IGL02869:Intu APN 3 40,642,216 (GRCm39) missense probably damaging 1.00
IGL03263:Intu APN 3 40,627,027 (GRCm39) nonsense probably null
H8562:Intu UTSW 3 40,647,103 (GRCm39) missense probably damaging 1.00
R0010:Intu UTSW 3 40,608,702 (GRCm39) intron probably benign
R0173:Intu UTSW 3 40,629,776 (GRCm39) critical splice donor site probably null
R0426:Intu UTSW 3 40,629,735 (GRCm39) missense probably damaging 0.97
R1566:Intu UTSW 3 40,647,008 (GRCm39) missense probably damaging 0.99
R1619:Intu UTSW 3 40,652,061 (GRCm39) nonsense probably null
R1658:Intu UTSW 3 40,647,211 (GRCm39) missense probably benign 0.20
R1701:Intu UTSW 3 40,618,694 (GRCm39) missense probably damaging 1.00
R1707:Intu UTSW 3 40,637,931 (GRCm39) missense possibly damaging 0.69
R1707:Intu UTSW 3 40,595,073 (GRCm39) missense probably benign 0.03
R1867:Intu UTSW 3 40,618,765 (GRCm39) missense probably damaging 1.00
R1868:Intu UTSW 3 40,618,765 (GRCm39) missense probably damaging 1.00
R2090:Intu UTSW 3 40,637,966 (GRCm39) missense probably benign 0.00
R2310:Intu UTSW 3 40,608,243 (GRCm39) missense probably benign
R2989:Intu UTSW 3 40,647,140 (GRCm39) missense probably benign 0.11
R4168:Intu UTSW 3 40,627,053 (GRCm39) missense probably benign 0.00
R4530:Intu UTSW 3 40,637,794 (GRCm39) missense possibly damaging 0.95
R5093:Intu UTSW 3 40,647,347 (GRCm39) missense probably benign 0.00
R5541:Intu UTSW 3 40,647,017 (GRCm39) splice site probably null
R5587:Intu UTSW 3 40,629,738 (GRCm39) missense probably damaging 0.99
R5745:Intu UTSW 3 40,647,402 (GRCm39) splice site probably null
R5809:Intu UTSW 3 40,634,020 (GRCm39) missense probably damaging 0.99
R5939:Intu UTSW 3 40,647,014 (GRCm39) missense probably damaging 1.00
R5953:Intu UTSW 3 40,633,980 (GRCm39) missense probably damaging 1.00
R6000:Intu UTSW 3 40,608,578 (GRCm39) nonsense probably null
R6063:Intu UTSW 3 40,608,524 (GRCm39) missense probably damaging 0.97
R6245:Intu UTSW 3 40,629,756 (GRCm39) missense probably damaging 0.98
R6310:Intu UTSW 3 40,655,721 (GRCm39) nonsense probably null
R6353:Intu UTSW 3 40,608,138 (GRCm39) missense probably damaging 1.00
R6451:Intu UTSW 3 40,655,723 (GRCm39) missense possibly damaging 0.94
R6660:Intu UTSW 3 40,586,100 (GRCm39) missense probably benign 0.00
R6848:Intu UTSW 3 40,648,685 (GRCm39) missense probably benign 0.00
R7440:Intu UTSW 3 40,651,981 (GRCm39) missense probably benign 0.04
R7625:Intu UTSW 3 40,652,029 (GRCm39) missense probably benign
R7633:Intu UTSW 3 40,608,683 (GRCm39) missense probably damaging 1.00
R7798:Intu UTSW 3 40,646,359 (GRCm39) missense probably damaging 1.00
R7877:Intu UTSW 3 40,654,222 (GRCm39) missense probably benign 0.07
R7978:Intu UTSW 3 40,652,069 (GRCm39) missense probably damaging 1.00
R8319:Intu UTSW 3 40,608,202 (GRCm39) missense probably damaging 1.00
R8332:Intu UTSW 3 40,629,719 (GRCm39) missense probably benign 0.35
R8860:Intu UTSW 3 40,627,162 (GRCm39) missense probably benign 0.07
R8926:Intu UTSW 3 40,608,139 (GRCm39) missense possibly damaging 0.69
R8946:Intu UTSW 3 40,637,789 (GRCm39) missense possibly damaging 0.93
R9164:Intu UTSW 3 40,645,133 (GRCm39) missense probably damaging 1.00
R9191:Intu UTSW 3 40,646,941 (GRCm39) missense probably damaging 0.99
R9547:Intu UTSW 3 40,608,536 (GRCm39) missense probably benign
Z1177:Intu UTSW 3 40,651,946 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CCTAACGTGTGCTTTAGCTAAG -3'
(R):5'- CTCAGTCCACCATTTCCAGAG -3'

Sequencing Primer
(F):5'- TAAGAACAGGGAATTAAACATTTGGC -3'
(R):5'- TTTCCAGAGGTAAAACTCCAGG -3'
Posted On 2019-06-07