Incidental Mutation 'PIT4495001:Intu'
ID555949
Institutional Source Beutler Lab
Gene Symbol Intu
Ensembl Gene ENSMUSG00000060798
Gene Nameinturned planar cell polarity protein
SynonymsPdzd6, Pdzk6, 9430087H23Rik, 9230116I04Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4495001 (G1)
Quality Score216.009
Status Not validated
Chromosome3
Chromosomal Location40531286-40704774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40697603 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 830 (Q830R)
Ref Sequence ENSEMBL: ENSMUSP00000088725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091186]
Predicted Effect probably benign
Transcript: ENSMUST00000091186
AA Change: Q830R

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000088725
Gene: ENSMUSG00000060798
AA Change: Q830R

DomainStartEndE-ValueType
low complexity region 21 48 N/A INTRINSIC
low complexity region 64 81 N/A INTRINSIC
PDZ 187 269 2.09e-3 SMART
low complexity region 459 468 N/A INTRINSIC
low complexity region 774 784 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.6%
  • 10x: 84.0%
  • 20x: 69.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice show defective ciliogenesis and neural tube closure, abnormal patterning of the CNS and limbs, polydactyly, edema and death by E16.5. Homozygotes for a hypomorphic allele show defective ciliation and endochondral ossification, stunted growth, polydactyly and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik A T 10: 100,583,950 F90I probably damaging Het
Abl2 T A 1: 156,633,185 V384D probably damaging Het
Adamts7 A G 9: 90,174,622 E248G probably damaging Het
Aff1 A G 5: 103,849,525 T1162A probably benign Het
Ank3 C A 10: 69,993,072 H2524N Het
Cct7 T A 6: 85,459,961 N60K probably damaging Het
Cfap43 A C 19: 47,897,302 C291W probably damaging Het
Cobl G A 11: 12,254,596 T702I probably benign Het
Col5a1 C A 2: 28,024,776 Q1624K unknown Het
Cubn T A 2: 13,491,750 T22S probably benign Het
Def8 A C 8: 123,459,553 M344L probably benign Het
Fzd7 A G 1: 59,484,307 T450A probably benign Het
Gm11214 G A 4: 63,662,685 L76F probably benign Het
Gm14548 A T 7: 3,897,458 C98S probably damaging Het
Gm5797 T C 14: 7,329,530 T153A probably benign Het
Gsk3a A C 7: 25,235,639 S129A probably damaging Het
Kcnma1 C T 14: 23,425,597 V750I probably benign Het
Mlh1 T A 9: 111,247,260 Y343F probably benign Het
Myb C T 10: 21,152,622 R114H probably damaging Het
Neb A T 2: 52,212,736 D4508E probably benign Het
Nell2 T C 15: 95,383,727 D366G probably benign Het
Olfr1354 T C 10: 78,916,987 V49A probably benign Het
Olfr1428 A G 19: 12,108,712 I52T possibly damaging Het
Olfr196 G T 16: 59,167,974 H56Q possibly damaging Het
Olfr209 A C 16: 59,361,508 F237V probably damaging Het
Olfr98 A C 17: 37,262,830 V278G possibly damaging Het
Pcdhgc5 C T 18: 37,820,977 H435Y possibly damaging Het
Pnpla7 T A 2: 25,042,139 D935E probably damaging Het
Pole A G 5: 110,303,914 E874G probably damaging Het
Psd3 A C 8: 67,963,913 I158R probably benign Het
Pzp C A 6: 128,502,229 V654L probably benign Het
Rabep1 A G 11: 70,917,579 T454A probably damaging Het
Rad54l2 C A 9: 106,716,144 S419I probably benign Het
Rin3 A G 12: 102,369,036 D402G probably benign Het
Ripk4 T C 16: 97,743,170 H759R probably damaging Het
Sbsn GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA 7: 30,752,966 probably benign Het
Sf3a3 C T 4: 124,728,320 P391L probably damaging Het
Snx9 T A 17: 5,920,126 I379K possibly damaging Het
Svs1 A T 6: 48,987,776 E239D possibly damaging Het
Syt5 A C 7: 4,541,078 probably null Het
Tex47 A G 5: 7,305,011 D64G probably benign Het
Zbbx C A 3: 75,061,637 W509L probably damaging Het
Zer1 T C 2: 30,103,543 K551R probably benign Het
Other mutations in Intu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Intu APN 3 40664266 missense probably benign 0.12
IGL01386:Intu APN 3 40692587 missense probably damaging 1.00
IGL02645:Intu APN 3 40701272 missense probably benign 0.01
IGL02869:Intu APN 3 40687786 missense probably damaging 1.00
IGL03263:Intu APN 3 40672597 nonsense probably null
H8562:Intu UTSW 3 40692673 missense probably damaging 1.00
R0010:Intu UTSW 3 40654272 intron probably benign
R0173:Intu UTSW 3 40675346 critical splice donor site probably null
R0426:Intu UTSW 3 40675305 missense probably damaging 0.97
R1566:Intu UTSW 3 40692578 missense probably damaging 0.99
R1619:Intu UTSW 3 40697631 nonsense probably null
R1658:Intu UTSW 3 40692781 missense probably benign 0.20
R1701:Intu UTSW 3 40664264 missense probably damaging 1.00
R1707:Intu UTSW 3 40540924 missense probably benign 0.03
R1707:Intu UTSW 3 40683501 missense possibly damaging 0.69
R1867:Intu UTSW 3 40664335 missense probably damaging 1.00
R1868:Intu UTSW 3 40664335 missense probably damaging 1.00
R2090:Intu UTSW 3 40683536 missense probably benign 0.00
R2310:Intu UTSW 3 40653813 missense probably benign
R2989:Intu UTSW 3 40692710 missense probably benign 0.11
R4168:Intu UTSW 3 40672623 missense probably benign 0.00
R4530:Intu UTSW 3 40683364 missense possibly damaging 0.95
R5093:Intu UTSW 3 40692917 missense probably benign 0.00
R5541:Intu UTSW 3 40692587 unclassified probably null
R5587:Intu UTSW 3 40675308 missense probably damaging 0.99
R5745:Intu UTSW 3 40692972 splice site probably null
R5809:Intu UTSW 3 40679590 missense probably damaging 0.99
R5939:Intu UTSW 3 40692584 missense probably damaging 1.00
R5953:Intu UTSW 3 40679550 missense probably damaging 1.00
R6000:Intu UTSW 3 40654148 nonsense probably null
R6063:Intu UTSW 3 40654094 missense probably damaging 0.97
R6245:Intu UTSW 3 40675326 missense probably damaging 0.98
R6310:Intu UTSW 3 40701291 nonsense probably null
R6353:Intu UTSW 3 40653708 missense probably damaging 1.00
R6451:Intu UTSW 3 40701293 missense possibly damaging 0.94
R6660:Intu UTSW 3 40531951 missense probably benign 0.00
R6848:Intu UTSW 3 40694255 missense probably benign 0.00
R7440:Intu UTSW 3 40697551 missense probably benign 0.04
R7625:Intu UTSW 3 40697599 missense probably benign
R7633:Intu UTSW 3 40654253 missense probably damaging 1.00
R7798:Intu UTSW 3 40691929 missense probably damaging 1.00
R7877:Intu UTSW 3 40699792 missense probably benign 0.07
R7978:Intu UTSW 3 40697639 missense probably damaging 1.00
R8319:Intu UTSW 3 40653772 missense probably damaging 1.00
R8332:Intu UTSW 3 40675289 missense probably benign 0.35
Z1177:Intu UTSW 3 40697516 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CCTAACGTGTGCTTTAGCTAAG -3'
(R):5'- CTCAGTCCACCATTTCCAGAG -3'

Sequencing Primer
(F):5'- TAAGAACAGGGAATTAAACATTTGGC -3'
(R):5'- TTTCCAGAGGTAAAACTCCAGG -3'
Posted On2019-06-07