Incidental Mutation 'R0604:Olfr325'
ID55595
Institutional Source Beutler Lab
Gene Symbol Olfr325
Ensembl Gene ENSMUSG00000060765
Gene Nameolfactory receptor 325
SynonymsMOR275-5, MOR275-11_p, GA_x6K02T2NKPP-844642-843680
MMRRC Submission 038793-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R0604 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location58577730-58582365 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58581348 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 168 (M168K)
Ref Sequence ENSEMBL: ENSMUSP00000145386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169428] [ENSMUST00000203418]
Predicted Effect probably damaging
Transcript: ENSMUST00000169428
AA Change: M168K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131257
Gene: ENSMUSG00000060765
AA Change: M168K

DomainStartEndE-ValueType
Pfam:7tm_4 35 312 2.3e-46 PFAM
Pfam:7TM_GPCR_Srsx 39 290 1.4e-6 PFAM
Pfam:7tm_1 45 294 1.6e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203418
AA Change: M168K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145386
Gene: ENSMUSG00000060765
AA Change: M168K

DomainStartEndE-ValueType
Pfam:7tm_4 35 130 7.6e-14 PFAM
Pfam:7TM_GPCR_Srsx 36 130 1.1e-4 PFAM
Pfam:7tm_1 45 130 2.6e-16 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik C A 2: 28,466,091 R60L possibly damaging Het
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Acap1 T C 11: 69,884,625 E302G probably benign Het
Adrb2 G A 18: 62,178,515 T413I possibly damaging Het
Aqr T C 2: 114,130,604 K725R probably benign Het
Braf A G 6: 39,623,697 I662T probably damaging Het
Ccdc178 A G 18: 22,067,443 S435P probably benign Het
Chd9 A G 8: 91,036,542 M2332V possibly damaging Het
Clgn T C 8: 83,424,194 V496A probably benign Het
Dnah17 A C 11: 118,121,471 S193R probably benign Het
Dntt A G 19: 41,053,149 E424G probably benign Het
Fam149a A G 8: 45,345,008 L492P probably damaging Het
Fetub T C 16: 22,935,660 Y126H possibly damaging Het
Fgfr3 A T 5: 33,732,782 Y96F probably damaging Het
Gm4952 A G 19: 12,624,672 E148G probably benign Het
Gucy2g T A 19: 55,203,087 L977F probably benign Het
Il1r1 T C 1: 40,282,246 V6A probably benign Het
Itsn2 C A 12: 4,658,189 Q832K probably benign Het
Lats1 T A 10: 7,712,661 F1014Y probably damaging Het
Mcc G A 18: 44,473,756 A536V probably damaging Het
Mtrf1 T C 14: 79,415,887 V334A possibly damaging Het
Olfr1179 T C 2: 88,402,383 T184A probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr50 T A 2: 36,794,107 Y290* probably null Het
Pard6g A G 18: 80,117,208 S179G probably damaging Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Psg27 A T 7: 18,557,072 V402D probably damaging Het
Rttn A G 18: 88,977,758 I222V probably damaging Het
Sp9 T A 2: 73,273,638 S179T probably benign Het
Tbc1d8 T A 1: 39,405,326 H184L probably damaging Het
Vmn1r69 A G 7: 10,580,654 V50A probably benign Het
Vmn2r58 A G 7: 41,860,576 F526L possibly damaging Het
Other mutations in Olfr325
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Olfr325 APN 11 58581810 missense probably benign
IGL01922:Olfr325 APN 11 58581073 missense probably benign 0.01
IGL02440:Olfr325 APN 11 58581209 missense probably damaging 1.00
IGL02456:Olfr325 APN 11 58581198 missense possibly damaging 0.48
IGL03088:Olfr325 APN 11 58581827 utr 3 prime probably benign
IGL03328:Olfr325 APN 11 58581713 missense probably damaging 1.00
R1698:Olfr325 UTSW 11 58581251 missense probably damaging 1.00
R2473:Olfr325 UTSW 11 58581575 missense probably damaging 1.00
R2888:Olfr325 UTSW 11 58581162 missense possibly damaging 0.96
R4133:Olfr325 UTSW 11 58581075 missense probably damaging 0.97
R4710:Olfr325 UTSW 11 58581722 missense probably damaging 1.00
R4715:Olfr325 UTSW 11 58581429 missense probably damaging 1.00
R4898:Olfr325 UTSW 11 58581720 missense probably damaging 1.00
R4939:Olfr325 UTSW 11 58581211 missense probably damaging 1.00
R4977:Olfr325 UTSW 11 58581629 missense possibly damaging 0.57
R5389:Olfr325 UTSW 11 58580999 missense possibly damaging 0.78
R5393:Olfr325 UTSW 11 58580999 missense possibly damaging 0.78
R6137:Olfr325 UTSW 11 58581068 missense probably benign
R6302:Olfr325 UTSW 11 58581638 missense probably benign
R6655:Olfr325 UTSW 11 58581210 missense probably damaging 1.00
R6927:Olfr325 UTSW 11 58581665 missense possibly damaging 0.81
R7451:Olfr325 UTSW 11 58581690 missense probably damaging 1.00
R7494:Olfr325 UTSW 11 58581212 missense probably damaging 0.97
R7626:Olfr325 UTSW 11 58581173 missense probably damaging 0.97
R7724:Olfr325 UTSW 11 58581382 missense probably benign 0.01
R7874:Olfr325 UTSW 11 58581747 missense possibly damaging 0.93
R8217:Olfr325 UTSW 11 58580966 missense probably benign 0.00
R8252:Olfr325 UTSW 11 58581132 missense probably damaging 1.00
Z1177:Olfr325 UTSW 11 58581311 missense probably damaging 1.00
Z1186:Olfr325 UTSW 11 58580924 missense probably benign 0.00
Z1186:Olfr325 UTSW 11 58580931 missense probably benign
Z1186:Olfr325 UTSW 11 58581002 missense probably benign
Z1186:Olfr325 UTSW 11 58581296 missense probably benign
Z1186:Olfr325 UTSW 11 58581657 missense probably benign
Z1187:Olfr325 UTSW 11 58580924 missense probably benign 0.00
Z1187:Olfr325 UTSW 11 58580931 missense probably benign
Z1187:Olfr325 UTSW 11 58581002 missense probably benign
Z1187:Olfr325 UTSW 11 58581296 missense probably benign
Z1187:Olfr325 UTSW 11 58581657 missense probably benign
Z1188:Olfr325 UTSW 11 58580924 missense probably benign 0.00
Z1188:Olfr325 UTSW 11 58580931 missense probably benign
Z1188:Olfr325 UTSW 11 58581002 missense probably benign
Z1188:Olfr325 UTSW 11 58581296 missense probably benign
Z1188:Olfr325 UTSW 11 58581657 missense probably benign
Z1189:Olfr325 UTSW 11 58580924 missense probably benign 0.00
Z1189:Olfr325 UTSW 11 58580931 missense probably benign
Z1189:Olfr325 UTSW 11 58581296 missense probably benign
Z1189:Olfr325 UTSW 11 58581657 missense probably benign
Z1190:Olfr325 UTSW 11 58580924 missense probably benign 0.00
Z1190:Olfr325 UTSW 11 58580931 missense probably benign
Z1190:Olfr325 UTSW 11 58581002 missense probably benign
Z1190:Olfr325 UTSW 11 58581296 missense probably benign
Z1190:Olfr325 UTSW 11 58581657 missense probably benign
Z1191:Olfr325 UTSW 11 58580924 missense probably benign 0.00
Z1191:Olfr325 UTSW 11 58580931 missense probably benign
Z1191:Olfr325 UTSW 11 58581002 missense probably benign
Z1191:Olfr325 UTSW 11 58581296 missense probably benign
Z1191:Olfr325 UTSW 11 58581657 missense probably benign
Z1192:Olfr325 UTSW 11 58580924 missense probably benign 0.00
Z1192:Olfr325 UTSW 11 58580931 missense probably benign
Z1192:Olfr325 UTSW 11 58581296 missense probably benign
Z1192:Olfr325 UTSW 11 58581657 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGGACCTCACCACCTGGATGAAC -3'
(R):5'- GCCTGAAATGACTGTCACAGGGATG -3'

Sequencing Primer
(F):5'- CTACCTGACATTAGCAGGGTC -3'
(R):5'- CTGTCACAGGGATGAGAAGC -3'
Posted On2013-07-11