Incidental Mutation 'PIT4495001:Sf3a3'
ID555952
Institutional Source Beutler Lab
Gene Symbol Sf3a3
Ensembl Gene ENSMUSG00000028902
Gene Namesplicing factor 3a, subunit 3
Synonyms4930512K19Rik, 60kDa
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #PIT4495001 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location124714776-124732460 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 124728320 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 391 (P391L)
Ref Sequence ENSEMBL: ENSMUSP00000030734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030734]
Predicted Effect probably damaging
Transcript: ENSMUST00000030734
AA Change: P391L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030734
Gene: ENSMUSG00000028902
AA Change: P391L

DomainStartEndE-ValueType
Pfam:SF3a60_bindingd 74 100 3e-19 PFAM
Pfam:SF3A3 129 207 7.9e-27 PFAM
Pfam:Telomere_Sde2_2 244 303 3.1e-31 PFAM
low complexity region 354 377 N/A INTRINSIC
ZnF_C2H2 406 431 9.3e-1 SMART
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.6%
  • 10x: 84.0%
  • 20x: 69.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes subunit 3 of the splicing factor 3a protein complex. The splicing factor 3a heterotrimer includes subunits 1, 2 and 3 and is necessary for the in vitro conversion of 15S U2 snRNP into an active 17S particle that performs pre-mRNA splicing. Subunit 3 interacts with subunit 1 through its amino-terminus while the zinc finger domain of subunit 3 plays a role in its binding to the 15S U2 snRNP. This gene has a pseudogene on chromosome 20. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik A T 10: 100,583,950 F90I probably damaging Het
Abl2 T A 1: 156,633,185 V384D probably damaging Het
Adamts7 A G 9: 90,174,622 E248G probably damaging Het
Aff1 A G 5: 103,849,525 T1162A probably benign Het
Ank3 C A 10: 69,993,072 H2524N Het
Cct7 T A 6: 85,459,961 N60K probably damaging Het
Cfap43 A C 19: 47,897,302 C291W probably damaging Het
Cobl G A 11: 12,254,596 T702I probably benign Het
Col5a1 C A 2: 28,024,776 Q1624K unknown Het
Cubn T A 2: 13,491,750 T22S probably benign Het
Def8 A C 8: 123,459,553 M344L probably benign Het
Fzd7 A G 1: 59,484,307 T450A probably benign Het
Gm11214 G A 4: 63,662,685 L76F probably benign Het
Gm14548 A T 7: 3,897,458 C98S probably damaging Het
Gm5797 T C 14: 7,329,530 T153A probably benign Het
Gsk3a A C 7: 25,235,639 S129A probably damaging Het
Intu A G 3: 40,697,603 Q830R probably benign Het
Kcnma1 C T 14: 23,425,597 V750I probably benign Het
Mlh1 T A 9: 111,247,260 Y343F probably benign Het
Myb C T 10: 21,152,622 R114H probably damaging Het
Neb A T 2: 52,212,736 D4508E probably benign Het
Nell2 T C 15: 95,383,727 D366G probably benign Het
Olfr1354 T C 10: 78,916,987 V49A probably benign Het
Olfr1428 A G 19: 12,108,712 I52T possibly damaging Het
Olfr196 G T 16: 59,167,974 H56Q possibly damaging Het
Olfr209 A C 16: 59,361,508 F237V probably damaging Het
Olfr98 A C 17: 37,262,830 V278G possibly damaging Het
Pcdhgc5 C T 18: 37,820,977 H435Y possibly damaging Het
Pnpla7 T A 2: 25,042,139 D935E probably damaging Het
Pole A G 5: 110,303,914 E874G probably damaging Het
Psd3 A C 8: 67,963,913 I158R probably benign Het
Pzp C A 6: 128,502,229 V654L probably benign Het
Rabep1 A G 11: 70,917,579 T454A probably damaging Het
Rad54l2 C A 9: 106,716,144 S419I probably benign Het
Rin3 A G 12: 102,369,036 D402G probably benign Het
Ripk4 T C 16: 97,743,170 H759R probably damaging Het
Sbsn GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA 7: 30,752,966 probably benign Het
Snx9 T A 17: 5,920,126 I379K possibly damaging Het
Svs1 A T 6: 48,987,776 E239D possibly damaging Het
Syt5 A C 7: 4,541,078 probably null Het
Tex47 A G 5: 7,305,011 D64G probably benign Het
Zbbx C A 3: 75,061,637 W509L probably damaging Het
Zer1 T C 2: 30,103,543 K551R probably benign Het
Other mutations in Sf3a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Sf3a3 APN 4 124718343 missense possibly damaging 0.93
IGL01623:Sf3a3 APN 4 124718343 missense possibly damaging 0.93
R0070:Sf3a3 UTSW 4 124714955 missense probably benign 0.04
R1441:Sf3a3 UTSW 4 124725142 missense probably damaging 0.99
R1858:Sf3a3 UTSW 4 124729495 missense probably damaging 1.00
R1928:Sf3a3 UTSW 4 124722093 missense possibly damaging 0.56
R1943:Sf3a3 UTSW 4 124715901 missense possibly damaging 0.95
R2101:Sf3a3 UTSW 4 124718343 missense possibly damaging 0.93
R2984:Sf3a3 UTSW 4 124718409 missense probably damaging 1.00
R3434:Sf3a3 UTSW 4 124725077 missense possibly damaging 0.95
R4366:Sf3a3 UTSW 4 124725139 missense probably benign
R4711:Sf3a3 UTSW 4 124728181 missense probably benign 0.01
R5032:Sf3a3 UTSW 4 124725166 missense probably benign 0.17
R5464:Sf3a3 UTSW 4 124728240 critical splice donor site probably null
R5607:Sf3a3 UTSW 4 124714953 missense probably damaging 1.00
R5997:Sf3a3 UTSW 4 124722058 missense probably damaging 0.99
R6166:Sf3a3 UTSW 4 124723384 intron probably benign
R7030:Sf3a3 UTSW 4 124722880 missense probably damaging 1.00
R7038:Sf3a3 UTSW 4 124728426 missense probably benign 0.16
R7157:Sf3a3 UTSW 4 124722900 missense probably damaging 0.98
R7184:Sf3a3 UTSW 4 124714979 missense probably benign 0.10
R7250:Sf3a3 UTSW 4 124722915 missense probably benign 0.03
Z1176:Sf3a3 UTSW 4 124714901 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CATGAAAATGTTCAGCGCAAG -3'
(R):5'- TTCAGCTCTGGACACCAATGG -3'

Sequencing Primer
(F):5'- CGCAAGCAAGCCAGGACAG -3'
(R):5'- CCAATGGCCCTCACAGG -3'
Posted On2019-06-07