Incidental Mutation 'R0604:Acap1'
ID55596
Institutional Source Beutler Lab
Gene Symbol Acap1
Ensembl Gene ENSMUSG00000001588
Gene NameArfGAP with coiled-coil, ankyrin repeat and PH domains 1
SynonymsCentb1
MMRRC Submission 038793-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0604 (G1)
Quality Score198
Status Not validated
Chromosome11
Chromosomal Location69881567-69895539 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69884625 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 302 (E302G)
Ref Sequence ENSEMBL: ENSMUSP00000104262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001631] [ENSMUST00000050555] [ENSMUST00000108622]
Predicted Effect probably benign
Transcript: ENSMUST00000001631
AA Change: E490G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000001631
Gene: ENSMUSG00000001588
AA Change: E490G

DomainStartEndE-ValueType
Pfam:BAR_3 5 240 2.1e-68 PFAM
PH 266 362 4.42e-15 SMART
ArfGap 405 527 2.42e-50 SMART
ANK 606 635 4.01e0 SMART
ANK 639 668 3.04e0 SMART
ANK 672 702 4.18e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000050555
SMART Domains Protein: ENSMUSP00000059107
Gene: ENSMUSG00000046731

DomainStartEndE-ValueType
Pfam:BTB_2 1 73 1.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108622
AA Change: E302G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000104262
Gene: ENSMUSG00000001588
AA Change: E302G

DomainStartEndE-ValueType
PH 78 174 4.42e-15 SMART
ArfGap 217 339 2.42e-50 SMART
ANK 418 447 4.01e0 SMART
ANK 451 480 3.04e0 SMART
ANK 484 514 4.18e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198919
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik C A 2: 28,466,091 R60L possibly damaging Het
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Adrb2 G A 18: 62,178,515 T413I possibly damaging Het
Aqr T C 2: 114,130,604 K725R probably benign Het
Braf A G 6: 39,623,697 I662T probably damaging Het
Ccdc178 A G 18: 22,067,443 S435P probably benign Het
Chd9 A G 8: 91,036,542 M2332V possibly damaging Het
Clgn T C 8: 83,424,194 V496A probably benign Het
Dnah17 A C 11: 118,121,471 S193R probably benign Het
Dntt A G 19: 41,053,149 E424G probably benign Het
Fam149a A G 8: 45,345,008 L492P probably damaging Het
Fetub T C 16: 22,935,660 Y126H possibly damaging Het
Fgfr3 A T 5: 33,732,782 Y96F probably damaging Het
Gm4952 A G 19: 12,624,672 E148G probably benign Het
Gucy2g T A 19: 55,203,087 L977F probably benign Het
Il1r1 T C 1: 40,282,246 V6A probably benign Het
Itsn2 C A 12: 4,658,189 Q832K probably benign Het
Lats1 T A 10: 7,712,661 F1014Y probably damaging Het
Mcc G A 18: 44,473,756 A536V probably damaging Het
Mtrf1 T C 14: 79,415,887 V334A possibly damaging Het
Olfr1179 T C 2: 88,402,383 T184A probably benign Het
Olfr325 T A 11: 58,581,348 M168K probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr50 T A 2: 36,794,107 Y290* probably null Het
Pard6g A G 18: 80,117,208 S179G probably damaging Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Psg27 A T 7: 18,557,072 V402D probably damaging Het
Rttn A G 18: 88,977,758 I222V probably damaging Het
Sp9 T A 2: 73,273,638 S179T probably benign Het
Tbc1d8 T A 1: 39,405,326 H184L probably damaging Het
Vmn1r69 A G 7: 10,580,654 V50A probably benign Het
Vmn2r58 A G 7: 41,860,576 F526L possibly damaging Het
Other mutations in Acap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Acap1 APN 11 69882691 missense possibly damaging 0.95
IGL01148:Acap1 APN 11 69890903 nonsense probably null
IGL01398:Acap1 APN 11 69881722 missense probably damaging 1.00
IGL01583:Acap1 APN 11 69881677 missense probably damaging 1.00
IGL02002:Acap1 APN 11 69884460 missense probably damaging 1.00
IGL02078:Acap1 APN 11 69895286 missense probably damaging 1.00
IGL02083:Acap1 APN 11 69889510 missense possibly damaging 0.74
IGL02535:Acap1 APN 11 69882694 missense probably benign 0.02
IGL02669:Acap1 APN 11 69894595 unclassified probably benign
IGL03125:Acap1 APN 11 69887038 missense probably damaging 1.00
Autobot UTSW 11 69881722 missense probably damaging 1.00
Drone UTSW 11 69890471 missense probably benign 0.21
R0127:Acap1 UTSW 11 69887217 splice site probably benign
R0243:Acap1 UTSW 11 69885426 missense probably damaging 0.98
R0863:Acap1 UTSW 11 69887056 missense probably damaging 0.98
R1331:Acap1 UTSW 11 69882376 splice site probably null
R1911:Acap1 UTSW 11 69881722 missense probably damaging 1.00
R1994:Acap1 UTSW 11 69889498 missense probably benign 0.41
R2411:Acap1 UTSW 11 69885485 missense probably damaging 1.00
R2442:Acap1 UTSW 11 69889491 missense possibly damaging 0.46
R2910:Acap1 UTSW 11 69887076 splice site probably benign
R4164:Acap1 UTSW 11 69890037 missense probably benign 0.22
R4223:Acap1 UTSW 11 69883685 missense probably damaging 0.99
R4562:Acap1 UTSW 11 69885351 intron probably benign
R4676:Acap1 UTSW 11 69889468 missense probably benign 0.22
R4852:Acap1 UTSW 11 69884376 missense probably benign 0.30
R4921:Acap1 UTSW 11 69887193 missense probably damaging 0.98
R4928:Acap1 UTSW 11 69885815 missense possibly damaging 0.81
R5536:Acap1 UTSW 11 69889307 missense probably benign 0.11
R5886:Acap1 UTSW 11 69884336 missense probably benign
R6053:Acap1 UTSW 11 69887070 critical splice acceptor site probably null
R6196:Acap1 UTSW 11 69887067 missense probably damaging 0.98
R6220:Acap1 UTSW 11 69889679 missense probably damaging 0.99
R6295:Acap1 UTSW 11 69890587 critical splice donor site probably null
R6333:Acap1 UTSW 11 69883601 missense possibly damaging 0.65
R6414:Acap1 UTSW 11 69884336 missense probably benign
R6848:Acap1 UTSW 11 69884661 missense probably damaging 1.00
R6952:Acap1 UTSW 11 69885517 missense probably benign 0.30
R7243:Acap1 UTSW 11 69890471 missense probably benign 0.21
R8066:Acap1 UTSW 11 69889863 missense probably benign 0.05
R8691:Acap1 UTSW 11 69890177 missense probably damaging 0.99
R8704:Acap1 UTSW 11 69882663 missense possibly damaging 0.49
X0012:Acap1 UTSW 11 69881689 missense probably damaging 1.00
X0027:Acap1 UTSW 11 69881723 missense probably damaging 1.00
Z1177:Acap1 UTSW 11 69882443 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCATGAATCCAGGCTTCCTTTTCC -3'
(R):5'- TTCAGCAGCAATGGTGAGCAGG -3'

Sequencing Primer
(F):5'- TCCTGCCTGGAGGTTAGAG -3'
(R):5'- GTCTTTTCAGGAGCAACAGC -3'
Posted On2013-07-11