Incidental Mutation 'PIT4495001:Sbsn'
ID555962
Institutional Source Beutler Lab
Gene Symbol Sbsn
Ensembl Gene ENSMUSG00000046056
Gene Namesuprabasin
Synonyms1110005D19Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #PIT4495001 (G1)
Quality Score167.475
Status Not validated
Chromosome7
Chromosomal Location30751471-30756134 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA to GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA at 30752966 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080518] [ENSMUST00000182227] [ENSMUST00000182229] [ENSMUST00000182721]
Predicted Effect probably benign
Transcript: ENSMUST00000080518
SMART Domains Protein: ENSMUSP00000079362
Gene: ENSMUSG00000046056

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
internal_repeat_2 27 208 2.58e-16 PROSPERO
internal_repeat_1 39 233 7e-25 PROSPERO
low complexity region 295 307 N/A INTRINSIC
low complexity region 313 325 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
low complexity region 349 361 N/A INTRINSIC
internal_repeat_2 380 568 2.58e-16 PROSPERO
internal_repeat_1 446 626 7e-25 PROSPERO
low complexity region 637 651 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182227
SMART Domains Protein: ENSMUSP00000138427
Gene: ENSMUSG00000046056

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 47 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182229
SMART Domains Protein: ENSMUSP00000138561
Gene: ENSMUSG00000046056

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 114 135 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182721
SMART Domains Protein: ENSMUSP00000138654
Gene: ENSMUSG00000046056

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
internal_repeat_1 26 68 1.41e-7 PROSPERO
internal_repeat_1 84 126 1.41e-7 PROSPERO
low complexity region 128 145 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.6%
  • 10x: 84.0%
  • 20x: 69.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik A T 10: 100,583,950 F90I probably damaging Het
Abl2 T A 1: 156,633,185 V384D probably damaging Het
Adamts7 A G 9: 90,174,622 E248G probably damaging Het
Aff1 A G 5: 103,849,525 T1162A probably benign Het
Ank3 C A 10: 69,993,072 H2524N Het
Cct7 T A 6: 85,459,961 N60K probably damaging Het
Cfap43 A C 19: 47,897,302 C291W probably damaging Het
Cobl G A 11: 12,254,596 T702I probably benign Het
Col5a1 C A 2: 28,024,776 Q1624K unknown Het
Cubn T A 2: 13,491,750 T22S probably benign Het
Def8 A C 8: 123,459,553 M344L probably benign Het
Fzd7 A G 1: 59,484,307 T450A probably benign Het
Gm11214 G A 4: 63,662,685 L76F probably benign Het
Gm14548 A T 7: 3,897,458 C98S probably damaging Het
Gm5797 T C 14: 7,329,530 T153A probably benign Het
Gsk3a A C 7: 25,235,639 S129A probably damaging Het
Intu A G 3: 40,697,603 Q830R probably benign Het
Kcnma1 C T 14: 23,425,597 V750I probably benign Het
Mlh1 T A 9: 111,247,260 Y343F probably benign Het
Myb C T 10: 21,152,622 R114H probably damaging Het
Neb A T 2: 52,212,736 D4508E probably benign Het
Nell2 T C 15: 95,383,727 D366G probably benign Het
Olfr1354 T C 10: 78,916,987 V49A probably benign Het
Olfr1428 A G 19: 12,108,712 I52T possibly damaging Het
Olfr196 G T 16: 59,167,974 H56Q possibly damaging Het
Olfr209 A C 16: 59,361,508 F237V probably damaging Het
Olfr98 A C 17: 37,262,830 V278G possibly damaging Het
Pcdhgc5 C T 18: 37,820,977 H435Y possibly damaging Het
Pnpla7 T A 2: 25,042,139 D935E probably damaging Het
Pole A G 5: 110,303,914 E874G probably damaging Het
Psd3 A C 8: 67,963,913 I158R probably benign Het
Pzp C A 6: 128,502,229 V654L probably benign Het
Rabep1 A G 11: 70,917,579 T454A probably damaging Het
Rad54l2 C A 9: 106,716,144 S419I probably benign Het
Rin3 A G 12: 102,369,036 D402G probably benign Het
Ripk4 T C 16: 97,743,170 H759R probably damaging Het
Sf3a3 C T 4: 124,728,320 P391L probably damaging Het
Snx9 T A 17: 5,920,126 I379K possibly damaging Het
Svs1 A T 6: 48,987,776 E239D possibly damaging Het
Syt5 A C 7: 4,541,078 probably null Het
Tex47 A G 5: 7,305,011 D64G probably benign Het
Zbbx C A 3: 75,061,637 W509L probably damaging Het
Zer1 T C 2: 30,103,543 K551R probably benign Het
Other mutations in Sbsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01479:Sbsn APN 7 30752357 missense possibly damaging 0.90
IGL02649:Sbsn APN 7 30753258 missense probably damaging 0.96
IGL03154:Sbsn APN 7 30751728 missense possibly damaging 0.94
PIT4687001:Sbsn UTSW 7 30752966 intron probably benign
R0427:Sbsn UTSW 7 30752098 intron probably benign
R0892:Sbsn UTSW 7 30754819 missense possibly damaging 0.46
R1129:Sbsn UTSW 7 30753440 missense probably benign
R1388:Sbsn UTSW 7 30752151 missense probably benign 0.09
R1437:Sbsn UTSW 7 30753053 nonsense probably null
R2436:Sbsn UTSW 7 30752230 missense possibly damaging 0.53
R4020:Sbsn UTSW 7 30755965 missense probably damaging 0.98
R5485:Sbsn UTSW 7 30753117 missense possibly damaging 0.46
R5890:Sbsn UTSW 7 30753267 missense possibly damaging 0.46
R6616:Sbsn UTSW 7 30753279 missense possibly damaging 0.92
R6969:Sbsn UTSW 7 30753191 missense probably benign
R7302:Sbsn UTSW 7 30751884 missense probably benign 0.34
R7455:Sbsn UTSW 7 30753177 missense possibly damaging 0.46
Z1088:Sbsn UTSW 7 30751751 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACTTAGCCATGCTGCAAAG -3'
(R):5'- AACCCAGTTTGGACCCCTTG -3'

Sequencing Primer
(F):5'- CCATGCTGCAAAGGAGGCAC -3'
(R):5'- TGGTTGACCCCAGTTTGGACAC -3'
Posted On2019-06-07