Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4495001:Rad54l2'

555966

Institutional Source

Beutler Lab

Gene Symbol

Rad54l2

Ensembl Gene

ENSMUSG00000040661

Gene Name

RAD54 like 2 (S. cerevisiae)

Synonyms

Srisnf2l, G630026H09Rik, Arip4

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

PIT4495001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

106688082-106789194 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 106716144 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Isoleucine at position 419 (S419I)

Ref Sequence

ENSEMBL: ENSMUSP00000045454 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046502]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000046502
AA Change: S419I

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000045454
Gene: ENSMUSG00000040661
AA Change: S419I

Domain	Start	End	E-Value	Type
coiled coil region	20	49	N/A	INTRINSIC
low complexity region	73	85	N/A	INTRINSIC
low complexity region	130	146	N/A	INTRINSIC
low complexity region	186	200	N/A	INTRINSIC
low complexity region	215	229	N/A	INTRINSIC
DEXDc	267	520	4.21e-20	SMART
HELICc	751	854	1.88e-17	SMART
low complexity region	959	976	N/A	INTRINSIC
low complexity region	1348	1368	N/A	INTRINSIC
low complexity region	1453	1460	N/A	INTRINSIC

Coding Region Coverage

1x: 93.1%
3x: 90.6%
10x: 84.0%
20x: 69.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null embryos show delayed growth, reduced cell proliferation, increased apoptosis and die by E11.5. At E9.5-E10.5, most major organs are smaller and the neural tube is shrunk in some cases. Mutant MEFs cease to grow after 2-3 passages showing increased apoptosis and reduced DNA synthesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430F08Rik	A	T	10: 100,583,950	F90I	probably damaging	Het
Abl2	T	A	1: 156,633,185	V384D	probably damaging	Het
Adamts7	A	G	9: 90,174,622	E248G	probably damaging	Het
Aff1	A	G	5: 103,849,525	T1162A	probably benign	Het
Ank3	C	A	10: 69,993,072	H2524N		Het
Cct7	T	A	6: 85,459,961	N60K	probably damaging	Het
Cfap43	A	C	19: 47,897,302	C291W	probably damaging	Het
Cobl	G	A	11: 12,254,596	T702I	probably benign	Het
Col5a1	C	A	2: 28,024,776	Q1624K	unknown	Het
Cubn	T	A	2: 13,491,750	T22S	probably benign	Het
Def8	A	C	8: 123,459,553	M344L	probably benign	Het
Fzd7	A	G	1: 59,484,307	T450A	probably benign	Het
Gm11214	G	A	4: 63,662,685	L76F	probably benign	Het
Gm14548	A	T	7: 3,897,458	C98S	probably damaging	Het
Gm5797	T	C	14: 7,329,530	T153A	probably benign	Het
Gsk3a	A	C	7: 25,235,639	S129A	probably damaging	Het
Intu	A	G	3: 40,697,603	Q830R	probably benign	Het
Kcnma1	C	T	14: 23,425,597	V750I	probably benign	Het
Mlh1	T	A	9: 111,247,260	Y343F	probably benign	Het
Myb	C	T	10: 21,152,622	R114H	probably damaging	Het
Neb	A	T	2: 52,212,736	D4508E	probably benign	Het
Nell2	T	C	15: 95,383,727	D366G	probably benign	Het
Olfr1354	T	C	10: 78,916,987	V49A	probably benign	Het
Olfr1428	A	G	19: 12,108,712	I52T	possibly damaging	Het
Olfr196	G	T	16: 59,167,974	H56Q	possibly damaging	Het
Olfr209	A	C	16: 59,361,508	F237V	probably damaging	Het
Olfr98	A	C	17: 37,262,830	V278G	possibly damaging	Het
Pcdhgc5	C	T	18: 37,820,977	H435Y	possibly damaging	Het
Pnpla7	T	A	2: 25,042,139	D935E	probably damaging	Het
Pole	A	G	5: 110,303,914	E874G	probably damaging	Het
Psd3	A	C	8: 67,963,913	I158R	probably benign	Het
Pzp	C	A	6: 128,502,229	V654L	probably benign	Het
Rabep1	A	G	11: 70,917,579	T454A	probably damaging	Het
Rin3	A	G	12: 102,369,036	D402G	probably benign	Het
Ripk4	T	C	16: 97,743,170	H759R	probably damaging	Het
Sbsn	GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA	GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA	7: 30,752,966		probably benign	Het
Sf3a3	C	T	4: 124,728,320	P391L	probably damaging	Het
Snx9	T	A	17: 5,920,126	I379K	possibly damaging	Het
Svs1	A	T	6: 48,987,776	E239D	possibly damaging	Het
Syt5	A	C	7: 4,541,078		probably null	Het
Tex47	A	G	5: 7,305,011	D64G	probably benign	Het
Zbbx	C	A	3: 75,061,637	W509L	probably damaging	Het
Zer1	T	C	2: 30,103,543	K551R	probably benign	Het

Other mutations in Rad54l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Rad54l2	APN	9	106700561	missense	probably benign
IGL00718:Rad54l2	APN	9	106713455	missense	probably damaging	1.00
IGL00917:Rad54l2	APN	9	106710439	missense	possibly damaging	0.95
IGL01319:Rad54l2	APN	9	106719046	missense	probably benign	0.18
IGL01447:Rad54l2	APN	9	106702772	missense	probably damaging	1.00
IGL01469:Rad54l2	APN	9	106722758	missense	probably damaging	1.00
IGL01836:Rad54l2	APN	9	106716157	missense	probably benign	0.00
IGL02017:Rad54l2	APN	9	106754040	missense	possibly damaging	0.85
IGL02179:Rad54l2	APN	9	106720390	missense	probably damaging	1.00
IGL02348:Rad54l2	APN	9	106720376	missense	probably damaging	1.00
IGL02822:Rad54l2	APN	9	106710407	missense	probably damaging	1.00
IGL03169:Rad54l2	APN	9	106719064	missense	probably benign	0.37
IGL03245:Rad54l2	APN	9	106703628	missense	probably damaging	1.00
IGL03253:Rad54l2	APN	9	106704223	missense	probably damaging	1.00
IGL02988:Rad54l2	UTSW	9	106700585	missense	probably benign
R0001:Rad54l2	UTSW	9	106708217	missense	probably damaging	0.97
R0069:Rad54l2	UTSW	9	106710365	missense	possibly damaging	0.67
R0069:Rad54l2	UTSW	9	106710365	missense	possibly damaging	0.67
R0114:Rad54l2	UTSW	9	106713455	missense	probably damaging	1.00
R0427:Rad54l2	UTSW	9	106693692	missense	possibly damaging	0.65
R0519:Rad54l2	UTSW	9	106708299	missense	probably damaging	0.98
R0760:Rad54l2	UTSW	9	106719606	critical splice donor site	probably null
R1018:Rad54l2	UTSW	9	106712390	missense	probably benign	0.32
R1630:Rad54l2	UTSW	9	106703629	missense	possibly damaging	0.79
R1701:Rad54l2	UTSW	9	106700493	critical splice donor site	probably null
R1903:Rad54l2	UTSW	9	106693717	splice site	probably null
R2187:Rad54l2	UTSW	9	106753992	small deletion	probably benign
R2205:Rad54l2	UTSW	9	106717798	missense	probably damaging	1.00
R2566:Rad54l2	UTSW	9	106703626	missense	possibly damaging	0.95
R2983:Rad54l2	UTSW	9	106700590	missense	probably benign	0.10
R3176:Rad54l2	UTSW	9	106753943	critical splice donor site	probably null
R3276:Rad54l2	UTSW	9	106753943	critical splice donor site	probably null
R3718:Rad54l2	UTSW	9	106693527	missense	probably benign
R4063:Rad54l2	UTSW	9	106720414	missense	probably benign	0.10
R4206:Rad54l2	UTSW	9	106717795	missense	probably damaging	1.00
R4271:Rad54l2	UTSW	9	106693626	missense	probably benign	0.22
R4377:Rad54l2	UTSW	9	106693222	missense	probably benign	0.00
R4700:Rad54l2	UTSW	9	106754025	missense	possibly damaging	0.85
R4729:Rad54l2	UTSW	9	106716118	missense	probably benign
R4872:Rad54l2	UTSW	9	106717892	missense	probably damaging	1.00
R4997:Rad54l2	UTSW	9	106722909	missense	possibly damaging	0.70
R5475:Rad54l2	UTSW	9	106705858	missense	probably damaging	1.00
R5658:Rad54l2	UTSW	9	106753992	small deletion	probably benign
R6246:Rad54l2	UTSW	9	106700493	critical splice donor site	probably null
R6248:Rad54l2	UTSW	9	106710338	missense	probably damaging	1.00
R6329:Rad54l2	UTSW	9	106717922	missense	possibly damaging	0.89
R6631:Rad54l2	UTSW	9	106713540	nonsense	probably null
R6773:Rad54l2	UTSW	9	106693317	missense	probably benign
R7148:Rad54l2	UTSW	9	106719119	nonsense	probably null
R7171:Rad54l2	UTSW	9	106713478	missense	probably damaging	1.00
R7226:Rad54l2	UTSW	9	106713472	missense	probably damaging	0.99
R7327:Rad54l2	UTSW	9	106693461	missense	possibly damaging	0.68
R7337:Rad54l2	UTSW	9	106705825	missense	probably damaging	1.00
R7636:Rad54l2	UTSW	9	106720387	missense	probably damaging	1.00
R7659:Rad54l2	UTSW	9	106713578	missense	probably benign	0.11
R7713:Rad54l2	UTSW	9	106717223	missense	probably damaging	1.00
R7748:Rad54l2	UTSW	9	106719034	missense	possibly damaging	0.53
R8021:Rad54l2	UTSW	9	106719641	missense	probably benign	0.00
R8084:Rad54l2	UTSW	9	106713502	missense	possibly damaging	0.63
R8552:Rad54l2	UTSW	9	106693578	missense	possibly damaging	0.77
R8768:Rad54l2	UTSW	9	106719610	missense	probably benign	0.04
R8952:Rad54l2	UTSW	9	106688851	unclassified	probably benign
R8953:Rad54l2	UTSW	9	106693262	missense	probably benign	0.02
R9041:Rad54l2	UTSW	9	106722819	missense	possibly damaging	0.85
R9296:Rad54l2	UTSW	9	106702743	missense	probably damaging	1.00
R9451:Rad54l2	UTSW	9	106708289	missense	probably benign	0.13
R9523:Rad54l2	UTSW	9	106695952	missense	probably damaging	1.00
R9657:Rad54l2	UTSW	9	106704173	missense	probably damaging	0.99
R9757:Rad54l2	UTSW	9	106717921	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGGTTGTTCCACCCAGATAGC -3'
(R):5'- CTGATTAGCAGCTGAAGCAAC -3'

Sequencing Primer
(F):5'- AGATAGCTGGTTTACGTTAACAATTC -3'
(R):5'- GCAGCTGAAGCAACAATATTTTC -3'

Posted On

2019-06-07