Mutagenetix > Incidental Mutations

Incidental Mutation 'PIT4495001:Ripk4'

555980

Institutional Source

Beutler Lab

Gene Symbol

Ripk4

Ensembl Gene

ENSMUSG00000005251

Gene Name

receptor-interacting serine-threonine kinase 4

Synonyms

Ankrd3, DIk, PKK, ANKK2, RIP4

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.197) question?

Stock #

PIT4495001 (G1)

Quality Score

161.009

Status

Not validated

Chromosome

Chromosomal Location

97741933-97763787 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 97743170 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 759 (H759R)

Ref Sequence

ENSEMBL: ENSMUSP00000019386 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019386]

Predicted Effect

probably damaging
Transcript: ENSMUST00000019386
AA Change: H759R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000019386
Gene: ENSMUSG00000005251
AA Change: H759R

Domain	Start	End	E-Value	Type
Pfam:Pkinase	22	283	1.8e-47	PFAM
Pfam:Pkinase_Tyr	23	283	6e-45	PFAM
low complexity region	356	396	N/A	INTRINSIC
ANK	439	468	2.58e-3	SMART
ANK	472	501	3.41e-3	SMART
ANK	505	534	7.42e-4	SMART
ANK	538	567	3.57e-6	SMART
ANK	571	601	3.85e-2	SMART
ANK	605	634	3.15e-7	SMART
ANK	638	667	5.16e-3	SMART
ANK	671	700	2.2e-6	SMART
ANK	704	734	1.68e-2	SMART
ANK	736	765	3.46e-4	SMART

Coding Region Coverage

1x: 93.1%
3x: 90.6%
10x: 84.0%
20x: 69.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine protein kinase that interacts with protein kinase C-delta. The encoded protein can also activate NFkappaB and is required for keratinocyte differentiation. This kinase undergoes autophosphorylation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in perinatal lethality and epithelial developmental defects. Homozygous mutant lack oral, anal, and nasal openings and display shorter hindlimbs and tail that are partially fused to the body. The skin is significantly thicker with areas of orthokeratosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430F08Rik	A	T	10: 100,583,950	F90I	probably damaging	Het
Abl2	T	A	1: 156,633,185	V384D	probably damaging	Het
Adamts7	A	G	9: 90,174,622	E248G	probably damaging	Het
Aff1	A	G	5: 103,849,525	T1162A	probably benign	Het
Ank3	C	A	10: 69,993,072	H2524N		Het
Cct7	T	A	6: 85,459,961	N60K	probably damaging	Het
Cfap43	A	C	19: 47,897,302	C291W	probably damaging	Het
Cobl	G	A	11: 12,254,596	T702I	probably benign	Het
Col5a1	C	A	2: 28,024,776	Q1624K	unknown	Het
Cubn	T	A	2: 13,491,750	T22S	probably benign	Het
Def8	A	C	8: 123,459,553	M344L	probably benign	Het
Fzd7	A	G	1: 59,484,307	T450A	probably benign	Het
Gm11214	G	A	4: 63,662,685	L76F	probably benign	Het
Gm14548	A	T	7: 3,897,458	C98S	probably damaging	Het
Gm5797	T	C	14: 7,329,530	T153A	probably benign	Het
Gsk3a	A	C	7: 25,235,639	S129A	probably damaging	Het
Intu	A	G	3: 40,697,603	Q830R	probably benign	Het
Kcnma1	C	T	14: 23,425,597	V750I	probably benign	Het
Mlh1	T	A	9: 111,247,260	Y343F	probably benign	Het
Myb	C	T	10: 21,152,622	R114H	probably damaging	Het
Neb	A	T	2: 52,212,736	D4508E	probably benign	Het
Nell2	T	C	15: 95,383,727	D366G	probably benign	Het
Olfr1354	T	C	10: 78,916,987	V49A	probably benign	Het
Olfr1428	A	G	19: 12,108,712	I52T	possibly damaging	Het
Olfr196	G	T	16: 59,167,974	H56Q	possibly damaging	Het
Olfr209	A	C	16: 59,361,508	F237V	probably damaging	Het
Olfr98	A	C	17: 37,262,830	V278G	possibly damaging	Het
Pcdhgc5	C	T	18: 37,820,977	H435Y	possibly damaging	Het
Pnpla7	T	A	2: 25,042,139	D935E	probably damaging	Het
Pole	A	G	5: 110,303,914	E874G	probably damaging	Het
Psd3	A	C	8: 67,963,913	I158R	probably benign	Het
Pzp	C	A	6: 128,502,229	V654L	probably benign	Het
Rabep1	A	G	11: 70,917,579	T454A	probably damaging	Het
Rad54l2	C	A	9: 106,716,144	S419I	probably benign	Het
Rin3	A	G	12: 102,369,036	D402G	probably benign	Het
Sbsn	GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA	GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA	7: 30,752,966		probably benign	Het
Sf3a3	C	T	4: 124,728,320	P391L	probably damaging	Het
Snx9	T	A	17: 5,920,126	I379K	possibly damaging	Het
Svs1	A	T	6: 48,987,776	E239D	possibly damaging	Het
Syt5	A	C	7: 4,541,078		probably null	Het
Tex47	A	G	5: 7,305,011	D64G	probably benign	Het
Zbbx	C	A	3: 75,061,637	W509L	probably damaging	Het
Zer1	T	C	2: 30,103,543	K551R	probably benign	Het

Other mutations in Ripk4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01548:Ripk4	APN	16	97751496	nonsense	probably null
IGL01823:Ripk4	APN	16	97755283	missense	possibly damaging	0.89
IGL01921:Ripk4	APN	16	97743365	missense	possibly damaging	0.62
IGL02023:Ripk4	APN	16	97755231	missense	probably damaging	1.00
IGL02201:Ripk4	APN	16	97755177	missense	possibly damaging	0.91
IGL02709:Ripk4	APN	16	97743566	missense	probably damaging	1.00
I2288:Ripk4	UTSW	16	97748145	missense	probably benign	0.16
R0060:Ripk4	UTSW	16	97763518	splice site	probably benign
R0112:Ripk4	UTSW	16	97743561	missense	probably benign	0.00
R0383:Ripk4	UTSW	16	97748112	missense	probably damaging	1.00
R0524:Ripk4	UTSW	16	97755287	nonsense	probably null
R0540:Ripk4	UTSW	16	97744175	missense	probably damaging	1.00
R0967:Ripk4	UTSW	16	97744172	missense	probably damaging	1.00
R1646:Ripk4	UTSW	16	97743897	missense	probably damaging	1.00
R1785:Ripk4	UTSW	16	97750131	missense	probably damaging	1.00
R2058:Ripk4	UTSW	16	97744142	nonsense	probably null
R2134:Ripk4	UTSW	16	97743733	missense	probably damaging	1.00
R2135:Ripk4	UTSW	16	97743733	missense	probably damaging	1.00
R3410:Ripk4	UTSW	16	97743957	missense	probably benign	0.00
R3411:Ripk4	UTSW	16	97743957	missense	probably benign	0.00
R4538:Ripk4	UTSW	16	97743152	nonsense	probably null
R4627:Ripk4	UTSW	16	97744026	missense	probably damaging	0.99
R4665:Ripk4	UTSW	16	97755073	missense	probably damaging	0.98
R4704:Ripk4	UTSW	16	97746004	nonsense	probably null
R4769:Ripk4	UTSW	16	97744062	missense	probably damaging	1.00
R4860:Ripk4	UTSW	16	97751536	missense	probably damaging	0.97
R4860:Ripk4	UTSW	16	97751536	missense	probably damaging	0.97
R5240:Ripk4	UTSW	16	97743767	missense	probably damaging	1.00
R5864:Ripk4	UTSW	16	97763582	missense	probably damaging	0.98
R6027:Ripk4	UTSW	16	97744074	missense	probably damaging	1.00
R6035:Ripk4	UTSW	16	97744187	missense	probably damaging	1.00
R6035:Ripk4	UTSW	16	97744187	missense	probably damaging	1.00
R6291:Ripk4	UTSW	16	97755123	missense	probably damaging	1.00
R6343:Ripk4	UTSW	16	97763526	critical splice donor site	probably benign
R6572:Ripk4	UTSW	16	97745905	nonsense	probably null
R6783:Ripk4	UTSW	16	97748037	missense	probably damaging	1.00
R6822:Ripk4	UTSW	16	97746036	missense	probably damaging	1.00
R7215:Ripk4	UTSW	16	97747323	splice site	probably null
R7251:Ripk4	UTSW	16	97743249	missense	probably benign
R7275:Ripk4	UTSW	16	97743957	missense	probably benign	0.00
R7356:Ripk4	UTSW	16	97743149	missense	probably damaging	0.98
R7621:Ripk4	UTSW	16	97745925	missense	probably damaging	1.00
R8065:Ripk4	UTSW	16	97763537	missense	probably damaging	0.97
R8067:Ripk4	UTSW	16	97763537	missense	probably damaging	0.97
R8191:Ripk4	UTSW	16	97763526	critical splice donor site	probably benign
Z1176:Ripk4	UTSW	16	97750102	missense	probably damaging	1.00
Z1177:Ripk4	UTSW	16	97755178	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- AGTGTCCCAGGACCATTCTG -3'
(R):5'- AATGGACACCTGGCTACTGTC -3'

Sequencing Primer
(F):5'- TTCTGTCCCCATGAGGAAACAAGG -3'
(R):5'- CTACTGTCAAGCTGCTCATAGAGG -3'

Posted On

2019-06-07