Incidental Mutation 'PIT4495001:Ripk4'
ID555980
Institutional Source Beutler Lab
Gene Symbol Ripk4
Ensembl Gene ENSMUSG00000005251
Gene Namereceptor-interacting serine-threonine kinase 4
SynonymsAnkrd3, DIk, PKK, ANKK2, RIP4
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.368) question?
Stock #PIT4495001 (G1)
Quality Score161.009
Status Not validated
Chromosome16
Chromosomal Location97741933-97763787 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97743170 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 759 (H759R)
Ref Sequence ENSEMBL: ENSMUSP00000019386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019386]
Predicted Effect probably damaging
Transcript: ENSMUST00000019386
AA Change: H759R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000019386
Gene: ENSMUSG00000005251
AA Change: H759R

DomainStartEndE-ValueType
Pfam:Pkinase 22 283 1.8e-47 PFAM
Pfam:Pkinase_Tyr 23 283 6e-45 PFAM
low complexity region 356 396 N/A INTRINSIC
ANK 439 468 2.58e-3 SMART
ANK 472 501 3.41e-3 SMART
ANK 505 534 7.42e-4 SMART
ANK 538 567 3.57e-6 SMART
ANK 571 601 3.85e-2 SMART
ANK 605 634 3.15e-7 SMART
ANK 638 667 5.16e-3 SMART
ANK 671 700 2.2e-6 SMART
ANK 704 734 1.68e-2 SMART
ANK 736 765 3.46e-4 SMART
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.6%
  • 10x: 84.0%
  • 20x: 69.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine protein kinase that interacts with protein kinase C-delta. The encoded protein can also activate NFkappaB and is required for keratinocyte differentiation. This kinase undergoes autophosphorylation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in perinatal lethality and epithelial developmental defects. Homozygous mutant lack oral, anal, and nasal openings and display shorter hindlimbs and tail that are partially fused to the body. The skin is significantly thicker with areas of orthokeratosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik A T 10: 100,583,950 F90I probably damaging Het
Abl2 T A 1: 156,633,185 V384D probably damaging Het
Adamts7 A G 9: 90,174,622 E248G probably damaging Het
Aff1 A G 5: 103,849,525 T1162A probably benign Het
Ank3 C A 10: 69,993,072 H2524N Het
Cct7 T A 6: 85,459,961 N60K probably damaging Het
Cfap43 A C 19: 47,897,302 C291W probably damaging Het
Cobl G A 11: 12,254,596 T702I probably benign Het
Col5a1 C A 2: 28,024,776 Q1624K unknown Het
Cubn T A 2: 13,491,750 T22S probably benign Het
Def8 A C 8: 123,459,553 M344L probably benign Het
Fzd7 A G 1: 59,484,307 T450A probably benign Het
Gm11214 G A 4: 63,662,685 L76F probably benign Het
Gm14548 A T 7: 3,897,458 C98S probably damaging Het
Gm5797 T C 14: 7,329,530 T153A probably benign Het
Gsk3a A C 7: 25,235,639 S129A probably damaging Het
Intu A G 3: 40,697,603 Q830R probably benign Het
Kcnma1 C T 14: 23,425,597 V750I probably benign Het
Mlh1 T A 9: 111,247,260 Y343F probably benign Het
Myb C T 10: 21,152,622 R114H probably damaging Het
Neb A T 2: 52,212,736 D4508E probably benign Het
Nell2 T C 15: 95,383,727 D366G probably benign Het
Olfr1354 T C 10: 78,916,987 V49A probably benign Het
Olfr1428 A G 19: 12,108,712 I52T possibly damaging Het
Olfr196 G T 16: 59,167,974 H56Q possibly damaging Het
Olfr209 A C 16: 59,361,508 F237V probably damaging Het
Olfr98 A C 17: 37,262,830 V278G possibly damaging Het
Pcdhgc5 C T 18: 37,820,977 H435Y possibly damaging Het
Pnpla7 T A 2: 25,042,139 D935E probably damaging Het
Pole A G 5: 110,303,914 E874G probably damaging Het
Psd3 A C 8: 67,963,913 I158R probably benign Het
Pzp C A 6: 128,502,229 V654L probably benign Het
Rabep1 A G 11: 70,917,579 T454A probably damaging Het
Rad54l2 C A 9: 106,716,144 S419I probably benign Het
Rin3 A G 12: 102,369,036 D402G probably benign Het
Sbsn GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA 7: 30,752,966 probably benign Het
Sf3a3 C T 4: 124,728,320 P391L probably damaging Het
Snx9 T A 17: 5,920,126 I379K possibly damaging Het
Svs1 A T 6: 48,987,776 E239D possibly damaging Het
Syt5 A C 7: 4,541,078 probably null Het
Tex47 A G 5: 7,305,011 D64G probably benign Het
Zbbx C A 3: 75,061,637 W509L probably damaging Het
Zer1 T C 2: 30,103,543 K551R probably benign Het
Other mutations in Ripk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Ripk4 APN 16 97751496 nonsense probably null
IGL01823:Ripk4 APN 16 97755283 missense possibly damaging 0.89
IGL01921:Ripk4 APN 16 97743365 missense possibly damaging 0.62
IGL02023:Ripk4 APN 16 97755231 missense probably damaging 1.00
IGL02201:Ripk4 APN 16 97755177 missense possibly damaging 0.91
IGL02709:Ripk4 APN 16 97743566 missense probably damaging 1.00
I2288:Ripk4 UTSW 16 97748145 missense probably benign 0.16
R0060:Ripk4 UTSW 16 97763518 splice site probably benign
R0112:Ripk4 UTSW 16 97743561 missense probably benign 0.00
R0383:Ripk4 UTSW 16 97748112 missense probably damaging 1.00
R0524:Ripk4 UTSW 16 97755287 nonsense probably null
R0540:Ripk4 UTSW 16 97744175 missense probably damaging 1.00
R0967:Ripk4 UTSW 16 97744172 missense probably damaging 1.00
R1646:Ripk4 UTSW 16 97743897 missense probably damaging 1.00
R1785:Ripk4 UTSW 16 97750131 missense probably damaging 1.00
R2058:Ripk4 UTSW 16 97744142 nonsense probably null
R2134:Ripk4 UTSW 16 97743733 missense probably damaging 1.00
R2135:Ripk4 UTSW 16 97743733 missense probably damaging 1.00
R3410:Ripk4 UTSW 16 97743957 missense probably benign 0.00
R3411:Ripk4 UTSW 16 97743957 missense probably benign 0.00
R4538:Ripk4 UTSW 16 97743152 nonsense probably null
R4627:Ripk4 UTSW 16 97744026 missense probably damaging 0.99
R4665:Ripk4 UTSW 16 97755073 missense probably damaging 0.98
R4704:Ripk4 UTSW 16 97746004 nonsense probably null
R4769:Ripk4 UTSW 16 97744062 missense probably damaging 1.00
R4860:Ripk4 UTSW 16 97751536 missense probably damaging 0.97
R4860:Ripk4 UTSW 16 97751536 missense probably damaging 0.97
R5240:Ripk4 UTSW 16 97743767 missense probably damaging 1.00
R5864:Ripk4 UTSW 16 97763582 missense probably damaging 0.98
R6027:Ripk4 UTSW 16 97744074 missense probably damaging 1.00
R6035:Ripk4 UTSW 16 97744187 missense probably damaging 1.00
R6035:Ripk4 UTSW 16 97744187 missense probably damaging 1.00
R6291:Ripk4 UTSW 16 97755123 missense probably damaging 1.00
R6343:Ripk4 UTSW 16 97763526 critical splice donor site probably null
R6572:Ripk4 UTSW 16 97745905 nonsense probably null
R6783:Ripk4 UTSW 16 97748037 missense probably damaging 1.00
R6822:Ripk4 UTSW 16 97746036 missense probably damaging 1.00
R7215:Ripk4 UTSW 16 97747323 synonymous probably null
R7251:Ripk4 UTSW 16 97743249 missense probably benign
R7275:Ripk4 UTSW 16 97743957 missense probably benign 0.00
R7356:Ripk4 UTSW 16 97743149 missense probably damaging 0.98
R7621:Ripk4 UTSW 16 97745925 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGTCCCAGGACCATTCTG -3'
(R):5'- AATGGACACCTGGCTACTGTC -3'

Sequencing Primer
(F):5'- TTCTGTCCCCATGAGGAAACAAGG -3'
(R):5'- CTACTGTCAAGCTGCTCATAGAGG -3'
Posted On2019-06-07