Incidental Mutation 'PIT4504001:Rims1'
ID 555986
Institutional Source Beutler Lab
Gene Symbol Rims1
Ensembl Gene ENSMUSG00000041670
Gene Name regulating synaptic membrane exocytosis 1
Synonyms RIM1alpha, C030033M19Rik, RIM1, RIM1a
Accession Numbers
Essential gene? Possibly essential (E-score: 0.671) question?
Stock # PIT4504001 (G1)
Quality Score 188.009
Status Not validated
Chromosome 1
Chromosomal Location 22356475-22845203 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 22467684 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 317 (I317L)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081544] [ENSMUST00000097809] [ENSMUST00000097810] [ENSMUST00000097811] [ENSMUST00000115273]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000081544
AA Change: I849L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000080259
Gene: ENSMUSG00000041670
AA Change: I849L

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 2.6e-9 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 899 934 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
C2 1120 1223 7.45e-15 SMART
low complexity region 1245 1253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097809
AA Change: I924L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000095418
Gene: ENSMUSG00000041670
AA Change: I924L

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 1e-9 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 862 874 N/A INTRINSIC
low complexity region 974 1009 N/A INTRINSIC
low complexity region 1086 1100 N/A INTRINSIC
C2 1195 1298 7.45e-15 SMART
low complexity region 1320 1328 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097810
AA Change: I985L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095419
Gene: ENSMUSG00000041670
AA Change: I985L

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
PDB:2CJS|C 131 193 2e-32 PDB
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 862 874 N/A INTRINSIC
low complexity region 916 929 N/A INTRINSIC
low complexity region 1035 1070 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
C2 1256 1359 7.45e-15 SMART
low complexity region 1381 1389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097811
AA Change: I1013L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000095420
Gene: ENSMUSG00000041670
AA Change: I1013L

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 1.6e-9 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 867 881 N/A INTRINSIC
low complexity region 944 957 N/A INTRINSIC
low complexity region 1063 1098 N/A INTRINSIC
low complexity region 1175 1189 N/A INTRINSIC
C2 1284 1387 7.45e-15 SMART
low complexity region 1409 1417 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115273
AA Change: I900L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000110928
Gene: ENSMUSG00000041670
AA Change: I900L

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 2.8e-9 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 950 985 N/A INTRINSIC
low complexity region 1062 1076 N/A INTRINSIC
C2 1171 1274 7.45e-15 SMART
low complexity region 1296 1304 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.6%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a RAS gene superfamily member that regulates synaptic vesicle exocytosis. This gene also plays a role in the regulation of voltage-gated calcium channels during neurotransmitter and insulin release. Mutations have suggested a role cognition and have been identified as the cause of cone-rod dystrophy type 7. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene display defects in maternal care and abnormalities in synaptic transmission in the central nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T A 2: 103,547,537 (GRCm39) C970* probably null Het
Adgrv1 G A 13: 81,707,471 (GRCm39) P1312S probably damaging Het
Arid5a T C 1: 36,356,706 (GRCm39) I116T probably damaging Het
Bank1 C A 3: 135,806,180 (GRCm39) D485Y probably damaging Het
Cbln3 C T 14: 56,120,956 (GRCm39) V122M probably damaging Het
Cox10 C T 11: 63,855,042 (GRCm39) C413Y possibly damaging Het
Ctsll3 T A 13: 60,948,823 (GRCm39) D44V probably benign Het
Cuzd1 A T 7: 130,911,529 (GRCm39) N483K possibly damaging Het
Dcaf4 G A 12: 83,580,785 (GRCm39) probably null Het
Ddx60 A G 8: 62,411,147 (GRCm39) T470A probably benign Het
Dennd1b T C 1: 138,967,742 (GRCm39) V44A probably benign Het
Dusp16 C A 6: 134,716,846 (GRCm39) V154F possibly damaging Het
Ect2 G A 3: 27,181,097 (GRCm39) R586* probably null Het
Ermard T A 17: 15,279,084 (GRCm39) C460* probably null Het
Fat2 C T 11: 55,146,936 (GRCm39) G4020D possibly damaging Het
Flacc1 T A 1: 58,698,258 (GRCm39) I348F probably benign Het
Galnt16 G T 12: 80,639,191 (GRCm39) E402* probably null Het
Gm5414 T G 15: 101,534,258 (GRCm39) D282A probably damaging Het
Gm6741 C T 17: 91,544,344 (GRCm39) Q36* probably null Het
Gm7356 A T 17: 14,221,720 (GRCm39) L103Q probably damaging Het
Hcn1 A G 13: 118,112,411 (GRCm39) T792A possibly damaging Het
Hemgn T C 4: 46,395,863 (GRCm39) N458D probably benign Het
Hesx1 C A 14: 26,723,838 (GRCm39) D140E probably benign Het
Hjv A T 3: 96,435,813 (GRCm39) D357V probably damaging Het
Hmgcr A G 13: 96,799,605 (GRCm39) I163T possibly damaging Het
Igfbpl1 T C 4: 45,813,469 (GRCm39) T249A possibly damaging Het
Il33 A T 19: 29,930,139 (GRCm39) H78L probably benign Het
Inpp4b A T 8: 82,768,564 (GRCm39) D691V probably damaging Het
Itpr2 T A 6: 146,131,369 (GRCm39) N1945I probably damaging Het
Lnpep A G 17: 17,799,289 (GRCm39) V122A probably benign Het
Lrp2 T C 2: 69,305,747 (GRCm39) D2938G probably damaging Het
Lrrc8c A T 5: 105,756,403 (GRCm39) Y726F probably benign Het
Magi3 G T 3: 103,922,842 (GRCm39) Q1292K probably benign Het
Mllt3 A C 4: 87,692,324 (GRCm39) F546L probably damaging Het
Mrpl14 A G 17: 46,009,147 (GRCm39) K82R probably benign Het
Noxred1 A G 12: 87,271,653 (GRCm39) V172A possibly damaging Het
Obscn A T 11: 59,023,948 (GRCm39) I574N probably damaging Het
Or2n1b A G 17: 38,460,060 (GRCm39) T194A probably benign Het
Or5k8 T A 16: 58,644,671 (GRCm39) T134S probably benign Het
Osbpl11 T A 16: 33,054,864 (GRCm39) V649D probably benign Het
Pdlim2 G T 14: 70,403,579 (GRCm39) P278T probably benign Het
Pm20d2 A C 4: 33,183,152 (GRCm39) L223V probably damaging Het
Pmpcb G T 5: 21,948,388 (GRCm39) R223L probably damaging Het
Pole2 A T 12: 69,256,759 (GRCm39) Y255* probably null Het
Scnn1g C A 7: 121,341,554 (GRCm39) H239N probably benign Het
Spag17 A G 3: 100,010,426 (GRCm39) probably null Het
Tenm3 A T 8: 48,746,692 (GRCm39) F1038I probably damaging Het
Tshz2 T C 2: 169,727,971 (GRCm39) F856L probably damaging Het
Ubtf A G 11: 102,197,508 (GRCm39) S715P unknown Het
Usp13 A C 3: 32,959,579 (GRCm39) S557R probably damaging Het
Usp19 T A 9: 108,370,169 (GRCm39) S43T probably benign Het
Vmn2r7 A T 3: 64,623,397 (GRCm39) Y308N probably benign Het
Zfp455 A G 13: 67,346,685 (GRCm39) D32G probably damaging Het
Zfp512 T A 5: 31,634,225 (GRCm39) probably null Het
Zfr A G 15: 12,166,244 (GRCm39) E838G possibly damaging Het
Other mutations in Rims1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Rims1 APN 1 22,507,323 (GRCm39) missense probably damaging 1.00
IGL00535:Rims1 APN 1 22,503,172 (GRCm39) missense probably benign 0.02
IGL01021:Rims1 APN 1 22,525,701 (GRCm39) missense probably damaging 1.00
IGL01106:Rims1 APN 1 22,449,671 (GRCm39) missense probably damaging 1.00
IGL01128:Rims1 APN 1 22,573,256 (GRCm39) missense probably damaging 0.97
IGL01548:Rims1 APN 1 22,577,683 (GRCm39) missense probably damaging 1.00
IGL01688:Rims1 APN 1 22,467,764 (GRCm39) missense probably benign 0.22
IGL02089:Rims1 APN 1 22,669,556 (GRCm39) missense possibly damaging 0.68
IGL02245:Rims1 APN 1 22,416,712 (GRCm39) missense probably damaging 0.98
IGL02355:Rims1 APN 1 22,522,288 (GRCm39) missense probably damaging 1.00
IGL02362:Rims1 APN 1 22,522,288 (GRCm39) missense probably damaging 1.00
IGL02682:Rims1 APN 1 22,358,708 (GRCm39) missense probably damaging 1.00
IGL03006:Rims1 APN 1 22,367,178 (GRCm39) missense probably damaging 0.99
IGL03054:Rims1 UTSW 1 22,360,333 (GRCm39) missense probably damaging 1.00
R0031:Rims1 UTSW 1 22,367,103 (GRCm39) missense probably damaging 1.00
R0118:Rims1 UTSW 1 22,416,631 (GRCm39) missense probably damaging 1.00
R0390:Rims1 UTSW 1 22,635,607 (GRCm39) missense possibly damaging 0.92
R0483:Rims1 UTSW 1 22,507,263 (GRCm39) splice site probably benign
R0744:Rims1 UTSW 1 22,497,709 (GRCm39) splice site probably null
R0836:Rims1 UTSW 1 22,497,709 (GRCm39) splice site probably null
R1218:Rims1 UTSW 1 22,522,256 (GRCm39) missense probably damaging 1.00
R1228:Rims1 UTSW 1 22,511,837 (GRCm39) missense probably null 1.00
R1374:Rims1 UTSW 1 22,367,172 (GRCm39) missense probably damaging 1.00
R1474:Rims1 UTSW 1 22,577,362 (GRCm39) splice site probably benign
R1652:Rims1 UTSW 1 22,363,090 (GRCm39) missense probably damaging 1.00
R1712:Rims1 UTSW 1 22,367,172 (GRCm39) missense probably damaging 1.00
R1730:Rims1 UTSW 1 22,416,753 (GRCm39) critical splice acceptor site probably null
R1783:Rims1 UTSW 1 22,416,753 (GRCm39) critical splice acceptor site probably null
R1861:Rims1 UTSW 1 22,635,639 (GRCm39) missense probably damaging 1.00
R1899:Rims1 UTSW 1 22,498,725 (GRCm39) missense probably damaging 1.00
R1937:Rims1 UTSW 1 22,358,754 (GRCm39) missense probably damaging 1.00
R2010:Rims1 UTSW 1 22,367,220 (GRCm39) missense probably damaging 1.00
R2049:Rims1 UTSW 1 22,635,516 (GRCm39) missense probably damaging 1.00
R2124:Rims1 UTSW 1 22,474,732 (GRCm39) nonsense probably null
R2860:Rims1 UTSW 1 22,503,227 (GRCm39) missense probably benign 0.01
R2861:Rims1 UTSW 1 22,503,227 (GRCm39) missense probably benign 0.01
R2914:Rims1 UTSW 1 22,844,711 (GRCm39) missense probably damaging 1.00
R3740:Rims1 UTSW 1 22,443,667 (GRCm39) missense probably damaging 1.00
R3741:Rims1 UTSW 1 22,443,667 (GRCm39) missense probably damaging 1.00
R3773:Rims1 UTSW 1 22,492,034 (GRCm39) missense probably damaging 1.00
R3874:Rims1 UTSW 1 22,498,740 (GRCm39) missense probably damaging 1.00
R3901:Rims1 UTSW 1 22,572,578 (GRCm39) missense probably benign 0.00
R3964:Rims1 UTSW 1 22,497,709 (GRCm39) splice site probably null
R4037:Rims1 UTSW 1 22,514,793 (GRCm39) missense probably damaging 0.96
R4039:Rims1 UTSW 1 22,514,793 (GRCm39) missense probably damaging 0.96
R4056:Rims1 UTSW 1 22,363,163 (GRCm39) splice site probably benign
R4062:Rims1 UTSW 1 22,572,664 (GRCm39) missense probably benign 0.00
R4552:Rims1 UTSW 1 22,443,718 (GRCm39) missense probably damaging 0.99
R4658:Rims1 UTSW 1 22,497,793 (GRCm39) missense probably damaging 0.98
R4688:Rims1 UTSW 1 22,518,528 (GRCm39) nonsense probably null
R4696:Rims1 UTSW 1 22,358,836 (GRCm39) missense probably damaging 1.00
R4720:Rims1 UTSW 1 22,497,731 (GRCm39) missense probably damaging 1.00
R4764:Rims1 UTSW 1 22,518,543 (GRCm39) missense probably damaging 1.00
R4780:Rims1 UTSW 1 22,361,329 (GRCm39) missense probably damaging 1.00
R4931:Rims1 UTSW 1 22,573,028 (GRCm39) missense probably benign 0.26
R5137:Rims1 UTSW 1 22,358,844 (GRCm39) nonsense probably null
R5153:Rims1 UTSW 1 22,522,328 (GRCm39) nonsense probably null
R5305:Rims1 UTSW 1 22,635,623 (GRCm39) missense probably damaging 0.99
R5354:Rims1 UTSW 1 22,577,592 (GRCm39) missense probably damaging 1.00
R5386:Rims1 UTSW 1 22,482,469 (GRCm39) missense probably damaging 0.99
R5485:Rims1 UTSW 1 22,522,289 (GRCm39) missense possibly damaging 0.93
R5643:Rims1 UTSW 1 22,577,590 (GRCm39) missense probably damaging 1.00
R5929:Rims1 UTSW 1 22,507,322 (GRCm39) missense probably damaging 1.00
R5988:Rims1 UTSW 1 22,635,544 (GRCm39) missense probably damaging 1.00
R6160:Rims1 UTSW 1 22,503,235 (GRCm39) missense probably damaging 0.98
R6579:Rims1 UTSW 1 22,496,166 (GRCm39) missense probably damaging 1.00
R6790:Rims1 UTSW 1 22,507,278 (GRCm39) missense probably damaging 1.00
R7048:Rims1 UTSW 1 22,511,901 (GRCm39) missense probably damaging 1.00
R7100:Rims1 UTSW 1 22,416,697 (GRCm39) missense probably benign 0.27
R7155:Rims1 UTSW 1 22,503,174 (GRCm39) missense probably damaging 0.99
R7171:Rims1 UTSW 1 22,498,740 (GRCm39) missense
R7448:Rims1 UTSW 1 22,474,699 (GRCm39) missense
R7505:Rims1 UTSW 1 22,573,077 (GRCm39) missense possibly damaging 0.55
R7567:Rims1 UTSW 1 22,507,291 (GRCm39) missense probably damaging 0.99
R7639:Rims1 UTSW 1 22,844,750 (GRCm39) missense probably benign 0.02
R7955:Rims1 UTSW 1 22,507,322 (GRCm39) missense probably damaging 1.00
R8005:Rims1 UTSW 1 22,482,437 (GRCm39) missense
R8071:Rims1 UTSW 1 22,358,760 (GRCm39) nonsense probably null
R8465:Rims1 UTSW 1 22,498,731 (GRCm39) missense possibly damaging 0.89
R8517:Rims1 UTSW 1 22,522,246 (GRCm39) missense probably damaging 1.00
R8703:Rims1 UTSW 1 22,496,137 (GRCm39) missense
R8726:Rims1 UTSW 1 22,633,181 (GRCm39) missense possibly damaging 0.88
R9090:Rims1 UTSW 1 22,498,773 (GRCm39) missense
R9179:Rims1 UTSW 1 22,482,490 (GRCm39) missense probably damaging 0.99
R9271:Rims1 UTSW 1 22,498,773 (GRCm39) missense
R9291:Rims1 UTSW 1 22,467,746 (GRCm39) missense
R9394:Rims1 UTSW 1 22,511,856 (GRCm39) missense probably damaging 1.00
R9578:Rims1 UTSW 1 22,523,823 (GRCm39) missense probably damaging 1.00
R9614:Rims1 UTSW 1 22,491,969 (GRCm39) nonsense probably null
R9726:Rims1 UTSW 1 22,669,493 (GRCm39) missense probably null 0.21
Z1088:Rims1 UTSW 1 22,358,810 (GRCm39) missense probably damaging 1.00
Z1176:Rims1 UTSW 1 22,523,752 (GRCm39) nonsense probably null
Z1177:Rims1 UTSW 1 22,511,858 (GRCm39) missense probably benign 0.44
Z1177:Rims1 UTSW 1 22,507,322 (GRCm39) missense probably damaging 1.00
Z1177:Rims1 UTSW 1 22,367,163 (GRCm39) missense possibly damaging 0.93
Z1177:Rims1 UTSW 1 22,511,885 (GRCm39) missense probably damaging 1.00
Z1186:Rims1 UTSW 1 22,449,706 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TTGTTACAAGGCACAAGAACTGG -3'
(R):5'- ATGAGGCCTGAACTCTGACC -3'

Sequencing Primer
(F):5'- CACAAGAACTGGGGGATAAAAGTAC -3'
(R):5'- GAACTCTGACCTCTTATTGCAGAG -3'
Posted On 2019-06-07