Incidental Mutation 'PIT4504001:Abtb2'
ID 555991
Institutional Source Beutler Lab
Gene Symbol Abtb2
Ensembl Gene ENSMUSG00000032724
Gene Name ankyrin repeat and BTB (POZ) domain containing 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # PIT4504001 (G1)
Quality Score 153.008
Status Not validated
Chromosome 2
Chromosomal Location 103566310-103718423 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 103717192 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 970 (C970*)
Ref Sequence ENSEMBL: ENSMUSP00000075566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028608] [ENSMUST00000076212]
AlphaFold Q7TQI7
Predicted Effect probably benign
Transcript: ENSMUST00000028608
SMART Domains Protein: ENSMUSP00000028608
Gene: ENSMUSG00000027185

DomainStartEndE-ValueType
Pfam:DUF1726 107 201 6.9e-39 PFAM
low complexity region 226 242 N/A INTRINSIC
Pfam:Helicase_RecD 281 488 1.3e-68 PFAM
Pfam:GNAT_acetyltr_2 528 753 7e-103 PFAM
Pfam:tRNA_bind_2 771 892 3.6e-46 PFAM
low complexity region 999 1024 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000076212
AA Change: C970*
SMART Domains Protein: ENSMUSP00000075566
Gene: ENSMUSG00000032724
AA Change: C970*

DomainStartEndE-ValueType
low complexity region 29 48 N/A INTRINSIC
low complexity region 122 143 N/A INTRINSIC
Blast:H2A 186 301 2e-38 BLAST
low complexity region 366 376 N/A INTRINSIC
ANK 521 550 4.78e-7 SMART
ANK 567 596 6.26e-2 SMART
ANK 606 635 3.65e-3 SMART
ANK 649 678 5.52e2 SMART
ANK 715 746 1.84e3 SMART
BTB 844 946 9.15e-24 SMART
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.6%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,559,352 P1312S probably damaging Het
Als2cr12 T A 1: 58,659,099 I348F probably benign Het
Arid5a T C 1: 36,317,625 I116T probably damaging Het
Bank1 C A 3: 136,100,419 D485Y probably damaging Het
Cbln3 C T 14: 55,883,499 V122M probably damaging Het
Cox10 C T 11: 63,964,216 C413Y possibly damaging Het
Ctsll3 T A 13: 60,801,009 D44V probably benign Het
Cuzd1 A T 7: 131,309,800 N483K possibly damaging Het
Dcaf4 G A 12: 83,534,011 probably null Het
Ddx60 A G 8: 61,958,113 T470A probably benign Het
Dennd1b T C 1: 139,040,004 V44A probably benign Het
Dusp16 C A 6: 134,739,883 V154F possibly damaging Het
Ect2 G A 3: 27,126,948 R586* probably null Het
Ermard T A 17: 15,058,822 C460* probably null Het
Fat2 C T 11: 55,256,110 G4020D possibly damaging Het
Galnt16 G T 12: 80,592,417 E402* probably null Het
Gm5414 T G 15: 101,625,823 D282A probably damaging Het
Gm6741 C T 17: 91,236,916 Q36* probably null Het
Gm7356 A T 17: 14,001,458 L103Q probably damaging Het
Hcn1 A G 13: 117,975,875 T792A possibly damaging Het
Hemgn T C 4: 46,395,863 N458D probably benign Het
Hesx1 C A 14: 27,001,881 D140E probably benign Het
Hfe2 A T 3: 96,528,497 D357V probably damaging Het
Hmgcr A G 13: 96,663,097 I163T possibly damaging Het
Igfbpl1 T C 4: 45,813,469 T249A possibly damaging Het
Il33 A T 19: 29,952,739 H78L probably benign Het
Inpp4b A T 8: 82,041,935 D691V probably damaging Het
Itpr2 T A 6: 146,229,871 N1945I probably damaging Het
Lnpep A G 17: 17,579,027 V122A probably benign Het
Lrp2 T C 2: 69,475,403 D2938G probably damaging Het
Lrrc8c A T 5: 105,608,537 Y726F probably benign Het
Magi3 G T 3: 104,015,526 Q1292K probably benign Het
Mllt3 A C 4: 87,774,087 F546L probably damaging Het
Mrpl14 A G 17: 45,698,221 K82R probably benign Het
Noxred1 A G 12: 87,224,879 V172A possibly damaging Het
Obscn A T 11: 59,133,122 I574N probably damaging Het
Olfr133 A G 17: 38,149,169 T194A probably benign Het
Olfr175-ps1 T A 16: 58,824,308 T134S probably benign Het
Osbpl11 T A 16: 33,234,494 V649D probably benign Het
Pdlim2 G T 14: 70,166,130 P278T probably benign Het
Pm20d2 A C 4: 33,183,152 L223V probably damaging Het
Pmpcb G T 5: 21,743,390 R223L probably damaging Het
Pole2 A T 12: 69,209,985 Y255* probably null Het
Rims1 T A 1: 22,397,460 I317L Het
Scnn1g C A 7: 121,742,331 H239N probably benign Het
Spag17 A G 3: 100,103,110 probably null Het
Tenm3 A T 8: 48,293,657 F1038I probably damaging Het
Tshz2 T C 2: 169,886,051 F856L probably damaging Het
Ubtf A G 11: 102,306,682 S715P unknown Het
Usp13 A C 3: 32,905,430 S557R probably damaging Het
Usp19 T A 9: 108,492,970 S43T probably benign Het
Vmn2r7 A T 3: 64,715,976 Y308N probably benign Het
Zfp455 A G 13: 67,198,621 D32G probably damaging Het
Zfp512 T A 5: 31,476,881 probably null Het
Zfr A G 15: 12,166,158 E838G possibly damaging Het
Other mutations in Abtb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Abtb2 APN 2 103705118 missense probably benign 0.00
IGL02605:Abtb2 APN 2 103717257 missense probably benign
IGL03161:Abtb2 APN 2 103567454 missense probably benign 0.02
R0147:Abtb2 UTSW 2 103567135 missense probably benign 0.04
R1052:Abtb2 UTSW 2 103705072 missense possibly damaging 0.46
R1419:Abtb2 UTSW 2 103709420 missense probably benign 0.00
R1518:Abtb2 UTSW 2 103709284 missense probably benign 0.03
R1650:Abtb2 UTSW 2 103702402 missense probably damaging 1.00
R1795:Abtb2 UTSW 2 103567024 missense probably benign 0.00
R2054:Abtb2 UTSW 2 103705117 missense probably benign 0.41
R2101:Abtb2 UTSW 2 103566862 missense probably benign 0.05
R2363:Abtb2 UTSW 2 103567183 missense probably damaging 1.00
R3440:Abtb2 UTSW 2 103567232 missense probably benign 0.43
R3927:Abtb2 UTSW 2 103708218 splice site probably null
R4351:Abtb2 UTSW 2 103683393 missense possibly damaging 0.46
R4352:Abtb2 UTSW 2 103683393 missense possibly damaging 0.46
R4782:Abtb2 UTSW 2 103717299 missense probably benign 0.35
R4814:Abtb2 UTSW 2 103717287 missense probably benign 0.08
R4831:Abtb2 UTSW 2 103683475 missense probably benign 0.06
R4900:Abtb2 UTSW 2 103567004 missense possibly damaging 0.62
R5038:Abtb2 UTSW 2 103567063 missense probably damaging 0.99
R5513:Abtb2 UTSW 2 103709278 critical splice acceptor site probably null
R6119:Abtb2 UTSW 2 103702310 missense probably benign 0.00
R6298:Abtb2 UTSW 2 103709488 missense probably benign 0.10
R6383:Abtb2 UTSW 2 103567376 missense probably damaging 0.98
R6860:Abtb2 UTSW 2 103709425 nonsense probably null
R7000:Abtb2 UTSW 2 103712442 missense possibly damaging 0.85
R7109:Abtb2 UTSW 2 103715515 missense probably benign 0.20
R7176:Abtb2 UTSW 2 103709375 missense probably benign 0.00
R7189:Abtb2 UTSW 2 103567516 missense probably benign 0.00
R7199:Abtb2 UTSW 2 103567220 missense possibly damaging 0.74
R7299:Abtb2 UTSW 2 103702424 splice site probably null
R7347:Abtb2 UTSW 2 103567412 missense probably damaging 1.00
R7469:Abtb2 UTSW 2 103566947 missense probably benign 0.00
R7629:Abtb2 UTSW 2 103683493 critical splice donor site probably null
R7862:Abtb2 UTSW 2 103702281 missense probably damaging 1.00
R8200:Abtb2 UTSW 2 103700817 missense probably benign 0.02
R8682:Abtb2 UTSW 2 103567375 missense probably benign 0.36
R8700:Abtb2 UTSW 2 103566944 missense probably damaging 0.99
R9164:Abtb2 UTSW 2 103711484 missense possibly damaging 0.50
R9196:Abtb2 UTSW 2 103683302 missense possibly damaging 0.71
R9254:Abtb2 UTSW 2 103711235 missense probably benign 0.00
R9258:Abtb2 UTSW 2 103716065 missense probably null 0.99
R9343:Abtb2 UTSW 2 103717160 missense probably benign
R9427:Abtb2 UTSW 2 103700899 missense probably damaging 1.00
R9675:Abtb2 UTSW 2 103708187 missense probably benign
Z1176:Abtb2 UTSW 2 103708172 nonsense probably null
Z1177:Abtb2 UTSW 2 103711196 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAACCAGGTACTCCCAGG -3'
(R):5'- TTGCACGCCCTCAGATAACAG -3'

Sequencing Primer
(F):5'- AGGTACTCCCAGGAGGTACTC -3'
(R):5'- GATAACAGTCCCCCTCCATCCTG -3'
Posted On 2019-06-07