Incidental Mutation 'PIT4504001:Hfe2'
ID555996
Institutional Source Beutler Lab
Gene Symbol Hfe2
Ensembl Gene ENSMUSG00000038403
Gene Namehemochromatosis type 2 (juvenile)
Synonyms5230400G09Rik, DL-M, Rgmc, hemojuvelin, HJV, 2310035L15Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4504001 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location96525172-96529210 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 96528497 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 357 (D357V)
Ref Sequence ENSEMBL: ENSMUSP00000046659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049208]
Predicted Effect probably damaging
Transcript: ENSMUST00000049208
AA Change: D357V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046659
Gene: ENSMUSG00000038403
AA Change: D357V

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:RGM_N 34 219 6.2e-61 PFAM
Pfam:RGM_C 223 389 4.7e-59 PFAM
transmembrane domain 397 419 N/A INTRINSIC
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.6%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is involved in iron metabolism. It may be a component of the signaling pathway which activates hepcidin or it may act as a modulator of hepcidin expression. It could also represent the cellular receptor for hepcidin. Two uORFs in the 5' UTR negatively regulate the expression and activity of the encoded protein. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. Defects in this gene are the cause of hemochromatosis type 2A, also called juvenile hemochromatosis (JH). JH is an early-onset autosomal recessive disorder due to severe iron overload resulting in hypogonadotrophic hypogonadism, hepatic fibrosis or cirrhosis and cardiomyopathy, occurring typically before age of 30. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lack of hepcidin expression, severe iron overload and male sterility. Mice homozygous for a different knock-out allele display systemic iron overload, a severe deficit in hepcidin production, overexpression of ferroportin but normal male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T A 2: 103,717,192 C970* probably null Het
Adgrv1 G A 13: 81,559,352 P1312S probably damaging Het
Als2cr12 T A 1: 58,659,099 I348F probably benign Het
Arid5a T C 1: 36,317,625 I116T probably damaging Het
Bank1 C A 3: 136,100,419 D485Y probably damaging Het
Cbln3 C T 14: 55,883,499 V122M probably damaging Het
Cox10 C T 11: 63,964,216 C413Y possibly damaging Het
Ctsll3 T A 13: 60,801,009 D44V probably benign Het
Cuzd1 A T 7: 131,309,800 N483K possibly damaging Het
Dcaf4 G A 12: 83,534,011 probably null Het
Ddx60 A G 8: 61,958,113 T470A probably benign Het
Dennd1b T C 1: 139,040,004 V44A probably benign Het
Dusp16 C A 6: 134,739,883 V154F possibly damaging Het
Ect2 G A 3: 27,126,948 R586* probably null Het
Ermard T A 17: 15,058,822 C460* probably null Het
Fat2 C T 11: 55,256,110 G4020D possibly damaging Het
Galnt16 G T 12: 80,592,417 E402* probably null Het
Gm5414 T G 15: 101,625,823 D282A probably damaging Het
Gm6741 C T 17: 91,236,916 Q36* probably null Het
Gm7356 A T 17: 14,001,458 L103Q probably damaging Het
Hcn1 A G 13: 117,975,875 T792A possibly damaging Het
Hemgn T C 4: 46,395,863 N458D probably benign Het
Hesx1 C A 14: 27,001,881 D140E probably benign Het
Hmgcr A G 13: 96,663,097 I163T possibly damaging Het
Igfbpl1 T C 4: 45,813,469 T249A possibly damaging Het
Il33 A T 19: 29,952,739 H78L probably benign Het
Inpp4b A T 8: 82,041,935 D691V probably damaging Het
Itpr2 T A 6: 146,229,871 N1945I probably damaging Het
Lnpep A G 17: 17,579,027 V122A probably benign Het
Lrp2 T C 2: 69,475,403 D2938G probably damaging Het
Lrrc8c A T 5: 105,608,537 Y726F probably benign Het
Magi3 G T 3: 104,015,526 Q1292K probably benign Het
Mllt3 A C 4: 87,774,087 F546L probably damaging Het
Mrpl14 A G 17: 45,698,221 K82R probably benign Het
Noxred1 A G 12: 87,224,879 V172A possibly damaging Het
Obscn A T 11: 59,133,122 I574N probably damaging Het
Olfr133 A G 17: 38,149,169 T194A probably benign Het
Olfr175-ps1 T A 16: 58,824,308 T134S probably benign Het
Osbpl11 T A 16: 33,234,494 V649D probably benign Het
Pdlim2 G T 14: 70,166,130 P278T probably benign Het
Pm20d2 A C 4: 33,183,152 L223V probably damaging Het
Pmpcb G T 5: 21,743,390 R223L probably damaging Het
Pole2 A T 12: 69,209,985 Y255* probably null Het
Rims1 T A 1: 22,397,460 I317L Het
Scnn1g C A 7: 121,742,331 H239N probably benign Het
Spag17 A G 3: 100,103,110 probably null Het
Tenm3 A T 8: 48,293,657 F1038I probably damaging Het
Tshz2 T C 2: 169,886,051 F856L probably damaging Het
Ubtf A G 11: 102,306,682 S715P unknown Het
Usp13 A C 3: 32,905,430 S557R probably damaging Het
Usp19 T A 9: 108,492,970 S43T probably benign Het
Vmn2r7 A T 3: 64,715,976 Y308N probably benign Het
Zfp455 A G 13: 67,198,621 D32G probably damaging Het
Zfp512 T A 5: 31,476,881 probably null Het
Zfr A G 15: 12,166,158 E838G possibly damaging Het
Other mutations in Hfe2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01671:Hfe2 APN 3 96528491 missense probably damaging 1.00
IGL02342:Hfe2 APN 3 96528172 missense possibly damaging 0.78
IGL03083:Hfe2 APN 3 96528606 missense probably benign 0.41
PIT4354001:Hfe2 UTSW 3 96528445 missense probably damaging 1.00
R4602:Hfe2 UTSW 3 96527553 missense probably benign 0.02
R5475:Hfe2 UTSW 3 96527283 missense probably benign 0.19
R5761:Hfe2 UTSW 3 96528622 missense probably benign 0.00
R7044:Hfe2 UTSW 3 96527474 missense possibly damaging 0.58
R7117:Hfe2 UTSW 3 96528226 missense possibly damaging 0.95
R7206:Hfe2 UTSW 3 96528128 missense probably damaging 1.00
Z1177:Hfe2 UTSW 3 96527197 missense possibly damaging 0.88
Z1177:Hfe2 UTSW 3 96528087 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- CTTCTCCATCAGGGTAGCAG -3'
(R):5'- GGCCTACTTACTGAAGCAAAGC -3'

Sequencing Primer
(F):5'- CTCCATCAGGGTAGCAGAGGATG -3'
(R):5'- TACTTACTGAAGCAAAGCCACAG -3'
Posted On2019-06-07