Incidental Mutation 'PIT4504001:Hemgn'
ID556002
Institutional Source Beutler Lab
Gene Symbol Hemgn
Ensembl Gene ENSMUSG00000028332
Gene Namehemogen
Synonyms4921524M03Rik, EDAG
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4504001 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location46393989-46413506 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46395863 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 458 (N458D)
Ref Sequence ENSEMBL: ENSMUSP00000066383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071096] [ENSMUST00000107764]
Predicted Effect probably benign
Transcript: ENSMUST00000071096
AA Change: N458D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000066383
Gene: ENSMUSG00000028332
AA Change: N458D

DomainStartEndE-ValueType
low complexity region 66 81 N/A INTRINSIC
internal_repeat_1 160 256 4.18e-7 PROSPERO
low complexity region 314 326 N/A INTRINSIC
internal_repeat_1 346 436 4.18e-7 PROSPERO
low complexity region 444 455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107764
AA Change: N458D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103393
Gene: ENSMUSG00000028332
AA Change: N458D

DomainStartEndE-ValueType
low complexity region 66 81 N/A INTRINSIC
internal_repeat_1 160 256 4.18e-7 PROSPERO
low complexity region 314 326 N/A INTRINSIC
internal_repeat_1 346 436 4.18e-7 PROSPERO
low complexity region 444 455 N/A INTRINSIC
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.6%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T A 2: 103,717,192 C970* probably null Het
Adgrv1 G A 13: 81,559,352 P1312S probably damaging Het
Als2cr12 T A 1: 58,659,099 I348F probably benign Het
Arid5a T C 1: 36,317,625 I116T probably damaging Het
Bank1 C A 3: 136,100,419 D485Y probably damaging Het
Cbln3 C T 14: 55,883,499 V122M probably damaging Het
Cox10 C T 11: 63,964,216 C413Y possibly damaging Het
Ctsll3 T A 13: 60,801,009 D44V probably benign Het
Cuzd1 A T 7: 131,309,800 N483K possibly damaging Het
Dcaf4 G A 12: 83,534,011 probably null Het
Ddx60 A G 8: 61,958,113 T470A probably benign Het
Dennd1b T C 1: 139,040,004 V44A probably benign Het
Dusp16 C A 6: 134,739,883 V154F possibly damaging Het
Ect2 G A 3: 27,126,948 R586* probably null Het
Ermard T A 17: 15,058,822 C460* probably null Het
Fat2 C T 11: 55,256,110 G4020D possibly damaging Het
Galnt16 G T 12: 80,592,417 E402* probably null Het
Gm5414 T G 15: 101,625,823 D282A probably damaging Het
Gm6741 C T 17: 91,236,916 Q36* probably null Het
Gm7356 A T 17: 14,001,458 L103Q probably damaging Het
Hcn1 A G 13: 117,975,875 T792A possibly damaging Het
Hesx1 C A 14: 27,001,881 D140E probably benign Het
Hfe2 A T 3: 96,528,497 D357V probably damaging Het
Hmgcr A G 13: 96,663,097 I163T possibly damaging Het
Igfbpl1 T C 4: 45,813,469 T249A possibly damaging Het
Il33 A T 19: 29,952,739 H78L probably benign Het
Inpp4b A T 8: 82,041,935 D691V probably damaging Het
Itpr2 T A 6: 146,229,871 N1945I probably damaging Het
Lnpep A G 17: 17,579,027 V122A probably benign Het
Lrp2 T C 2: 69,475,403 D2938G probably damaging Het
Lrrc8c A T 5: 105,608,537 Y726F probably benign Het
Magi3 G T 3: 104,015,526 Q1292K probably benign Het
Mllt3 A C 4: 87,774,087 F546L probably damaging Het
Mrpl14 A G 17: 45,698,221 K82R probably benign Het
Noxred1 A G 12: 87,224,879 V172A possibly damaging Het
Obscn A T 11: 59,133,122 I574N probably damaging Het
Olfr133 A G 17: 38,149,169 T194A probably benign Het
Olfr175-ps1 T A 16: 58,824,308 T134S probably benign Het
Osbpl11 T A 16: 33,234,494 V649D probably benign Het
Pdlim2 G T 14: 70,166,130 P278T probably benign Het
Pm20d2 A C 4: 33,183,152 L223V probably damaging Het
Pmpcb G T 5: 21,743,390 R223L probably damaging Het
Pole2 A T 12: 69,209,985 Y255* probably null Het
Rims1 T A 1: 22,397,460 I317L Het
Scnn1g C A 7: 121,742,331 H239N probably benign Het
Spag17 A G 3: 100,103,110 probably null Het
Tenm3 A T 8: 48,293,657 F1038I probably damaging Het
Tshz2 T C 2: 169,886,051 F856L probably damaging Het
Ubtf A G 11: 102,306,682 S715P unknown Het
Usp13 A C 3: 32,905,430 S557R probably damaging Het
Usp19 T A 9: 108,492,970 S43T probably benign Het
Vmn2r7 A T 3: 64,715,976 Y308N probably benign Het
Zfp455 A G 13: 67,198,621 D32G probably damaging Het
Zfp512 T A 5: 31,476,881 probably null Het
Zfr A G 15: 12,166,158 E838G possibly damaging Het
Other mutations in Hemgn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Hemgn APN 4 46396240 missense probably benign
IGL00846:Hemgn APN 4 46396171 missense possibly damaging 0.91
IGL00930:Hemgn APN 4 46396383 nonsense probably null
IGL01875:Hemgn APN 4 46396994 missense possibly damaging 0.65
IGL01937:Hemgn APN 4 46396057 missense probably damaging 1.00
IGL02217:Hemgn APN 4 46396420 missense probably damaging 0.98
IGL02325:Hemgn APN 4 46396085 missense probably benign 0.05
IGL02746:Hemgn APN 4 46400740 missense probably damaging 0.99
IGL03093:Hemgn APN 4 46396504 missense probably benign 0.26
IGL03240:Hemgn APN 4 46400732 nonsense probably null
R0925:Hemgn UTSW 4 46397049 missense probably damaging 0.98
R1413:Hemgn UTSW 4 46396091 missense possibly damaging 0.94
R1795:Hemgn UTSW 4 46395958 missense probably damaging 0.97
R1844:Hemgn UTSW 4 46396655 missense possibly damaging 0.85
R2152:Hemgn UTSW 4 46396607 nonsense probably null
R2169:Hemgn UTSW 4 46396417 missense possibly damaging 0.92
R2207:Hemgn UTSW 4 46396301 missense possibly damaging 0.66
R3742:Hemgn UTSW 4 46396421 missense possibly damaging 0.94
R4515:Hemgn UTSW 4 46396477 missense probably damaging 0.98
R5310:Hemgn UTSW 4 46403927 missense possibly damaging 0.77
R5445:Hemgn UTSW 4 46400738 missense probably benign 0.09
R5456:Hemgn UTSW 4 46396571 missense probably damaging 0.99
R6520:Hemgn UTSW 4 46396466 missense probably damaging 0.98
R6575:Hemgn UTSW 4 46395990 missense possibly damaging 0.46
R6983:Hemgn UTSW 4 46395997 missense possibly damaging 0.92
R7204:Hemgn UTSW 4 46397054 missense possibly damaging 0.94
R7443:Hemgn UTSW 4 46396145 missense probably damaging 0.96
R7567:Hemgn UTSW 4 46397034 missense probably damaging 0.96
R7623:Hemgn UTSW 4 46396504 missense probably benign 0.07
Z1177:Hemgn UTSW 4 46400693 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGCACATAATTAACCCTATTCCAGG -3'
(R):5'- CCTGGGCCTGAGAACTATTC -3'

Sequencing Primer
(F):5'- AATTAACCCTATTCCAGGTTTGTTTC -3'
(R):5'- GGCCTGAGAACTATTCACTGG -3'
Posted On2019-06-07