Incidental Mutation 'PIT4504001:Mllt3'
ID556003
Institutional Source Beutler Lab
Gene Symbol Mllt3
Ensembl Gene ENSMUSG00000028496
Gene Namemyeloid/lymphoid or mixed-lineage leukemia; translocated to, 3
SynonymsAf9, D4Ertd321e, 2610012I03Rik, 3830408D16Rik, 2210011H10Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4504001 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location87769925-88033364 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 87774087 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 546 (F546L)
Ref Sequence ENSEMBL: ENSMUSP00000077232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078090] [ENSMUST00000126353] [ENSMUST00000148059] [ENSMUST00000149357]
Predicted Effect probably damaging
Transcript: ENSMUST00000078090
AA Change: F546L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077232
Gene: ENSMUSG00000028496
AA Change: F546L

DomainStartEndE-ValueType
Pfam:YEATS 29 110 2.3e-29 PFAM
SCOP:d1l9ha_ 126 173 9e-3 SMART
internal_repeat_1 195 214 9.17e-5 PROSPERO
internal_repeat_1 206 225 9.17e-5 PROSPERO
low complexity region 226 246 N/A INTRINSIC
low complexity region 291 314 N/A INTRINSIC
SCOP:d1qbkb_ 315 467 7e-4 SMART
PDB:2LM0|A 485 569 3e-48 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000126353
AA Change: F115L

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129523
Gene: ENSMUSG00000028496
AA Change: F115L

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
PDB:2LM0|A 76 138 1e-29 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000148059
AA Change: F31L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131095
Gene: ENSMUSG00000028496
AA Change: F31L

DomainStartEndE-ValueType
PDB:2LM0|A 1 54 6e-34 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000149357
AA Change: F139L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128366
Gene: ENSMUSG00000028496
AA Change: F139L

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
PDB:2LM0|A 76 162 4e-54 PDB
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.6%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: About 50% of homozygous null mice die perinatally while the remaining 50% become runted and die within two weeks of birth with severe defects of the axial skeleton, including anterior homeotic transformation of the cervical and thoracic regions, a deformed atlas and an extra cervical vertebra. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T A 2: 103,717,192 C970* probably null Het
Adgrv1 G A 13: 81,559,352 P1312S probably damaging Het
Als2cr12 T A 1: 58,659,099 I348F probably benign Het
Arid5a T C 1: 36,317,625 I116T probably damaging Het
Bank1 C A 3: 136,100,419 D485Y probably damaging Het
Cbln3 C T 14: 55,883,499 V122M probably damaging Het
Cox10 C T 11: 63,964,216 C413Y possibly damaging Het
Ctsll3 T A 13: 60,801,009 D44V probably benign Het
Cuzd1 A T 7: 131,309,800 N483K possibly damaging Het
Dcaf4 G A 12: 83,534,011 probably null Het
Ddx60 A G 8: 61,958,113 T470A probably benign Het
Dennd1b T C 1: 139,040,004 V44A probably benign Het
Dusp16 C A 6: 134,739,883 V154F possibly damaging Het
Ect2 G A 3: 27,126,948 R586* probably null Het
Ermard T A 17: 15,058,822 C460* probably null Het
Fat2 C T 11: 55,256,110 G4020D possibly damaging Het
Galnt16 G T 12: 80,592,417 E402* probably null Het
Gm5414 T G 15: 101,625,823 D282A probably damaging Het
Gm6741 C T 17: 91,236,916 Q36* probably null Het
Gm7356 A T 17: 14,001,458 L103Q probably damaging Het
Hcn1 A G 13: 117,975,875 T792A possibly damaging Het
Hemgn T C 4: 46,395,863 N458D probably benign Het
Hesx1 C A 14: 27,001,881 D140E probably benign Het
Hfe2 A T 3: 96,528,497 D357V probably damaging Het
Hmgcr A G 13: 96,663,097 I163T possibly damaging Het
Igfbpl1 T C 4: 45,813,469 T249A possibly damaging Het
Il33 A T 19: 29,952,739 H78L probably benign Het
Inpp4b A T 8: 82,041,935 D691V probably damaging Het
Itpr2 T A 6: 146,229,871 N1945I probably damaging Het
Lnpep A G 17: 17,579,027 V122A probably benign Het
Lrp2 T C 2: 69,475,403 D2938G probably damaging Het
Lrrc8c A T 5: 105,608,537 Y726F probably benign Het
Magi3 G T 3: 104,015,526 Q1292K probably benign Het
Mrpl14 A G 17: 45,698,221 K82R probably benign Het
Noxred1 A G 12: 87,224,879 V172A possibly damaging Het
Obscn A T 11: 59,133,122 I574N probably damaging Het
Olfr133 A G 17: 38,149,169 T194A probably benign Het
Olfr175-ps1 T A 16: 58,824,308 T134S probably benign Het
Osbpl11 T A 16: 33,234,494 V649D probably benign Het
Pdlim2 G T 14: 70,166,130 P278T probably benign Het
Pm20d2 A C 4: 33,183,152 L223V probably damaging Het
Pmpcb G T 5: 21,743,390 R223L probably damaging Het
Pole2 A T 12: 69,209,985 Y255* probably null Het
Rims1 T A 1: 22,397,460 I317L Het
Scnn1g C A 7: 121,742,331 H239N probably benign Het
Spag17 A G 3: 100,103,110 probably null Het
Tenm3 A T 8: 48,293,657 F1038I probably damaging Het
Tshz2 T C 2: 169,886,051 F856L probably damaging Het
Ubtf A G 11: 102,306,682 S715P unknown Het
Usp13 A C 3: 32,905,430 S557R probably damaging Het
Usp19 T A 9: 108,492,970 S43T probably benign Het
Vmn2r7 A T 3: 64,715,976 Y308N probably benign Het
Zfp455 A G 13: 67,198,621 D32G probably damaging Het
Zfp512 T A 5: 31,476,881 probably null Het
Zfr A G 15: 12,166,158 E838G possibly damaging Het
Other mutations in Mllt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Mllt3 APN 4 87791881 missense probably benign 0.00
IGL01078:Mllt3 APN 4 87880060 splice site probably benign
IGL01337:Mllt3 APN 4 87840820 missense probably damaging 0.99
IGL02664:Mllt3 APN 4 88031623 missense probably damaging 1.00
R0226:Mllt3 UTSW 4 87840732 missense probably benign 0.00
R0415:Mllt3 UTSW 4 87841339 utr 3 prime probably benign
R0540:Mllt3 UTSW 4 87841044 missense possibly damaging 0.73
R0618:Mllt3 UTSW 4 87841267 utr 3 prime probably benign
R0932:Mllt3 UTSW 4 87789384 missense probably damaging 0.99
R1713:Mllt3 UTSW 4 87783664 missense probably damaging 1.00
R4748:Mllt3 UTSW 4 87840781 missense possibly damaging 0.60
R4928:Mllt3 UTSW 4 87782405 intron probably null
R5086:Mllt3 UTSW 4 87789298 missense probably damaging 0.99
R5186:Mllt3 UTSW 4 87840995 missense probably benign 0.00
R5359:Mllt3 UTSW 4 87840927 missense probably benign 0.21
R5371:Mllt3 UTSW 4 87840856 missense possibly damaging 0.64
R5713:Mllt3 UTSW 4 87841211 missense probably benign 0.01
R5787:Mllt3 UTSW 4 87840820 missense probably damaging 0.99
R6346:Mllt3 UTSW 4 87841208 missense probably damaging 1.00
R6462:Mllt3 UTSW 4 87774101 missense probably damaging 1.00
R6621:Mllt3 UTSW 4 87840797 missense possibly damaging 0.66
R6629:Mllt3 UTSW 4 87841267 utr 3 prime probably benign
R7380:Mllt3 UTSW 4 87791943 missense possibly damaging 0.85
R7600:Mllt3 UTSW 4 87841219 missense probably benign 0.07
R8045:Mllt3 UTSW 4 87841113 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGGGATTTCCTTGCAGAG -3'
(R):5'- CAGGTAGTTTGGAAATAGTATAGCC -3'

Sequencing Primer
(F):5'- GGTAACCTCTCCTTTATCAAGAGATG -3'
(R):5'- AGTTTGGAAATAGTATAGCCTTGTTG -3'
Posted On2019-06-07