Mutagenetix > Incidental Mutations

Incidental Mutation 'PIT4504001:Pmpcb'

556004

Institutional Source

Beutler Lab

Gene Symbol

Pmpcb

Ensembl Gene

ENSMUSG00000029017

Gene Name

peptidase (mitochondrial processing) beta

Synonyms

MPPP52, MPP11, 3110004O18Rik

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

PIT4504001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

21737141-21757152 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 21743390 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 223 (R223L)

Ref Sequence

ENSEMBL: ENSMUSP00000030882 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030882] [ENSMUST00000149648]

Predicted Effect

probably damaging
Transcript: ENSMUST00000030882
AA Change: R223L

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000030882
Gene: ENSMUSG00000029017
AA Change: R223L

Domain	Start	End	E-Value	Type
low complexity region	23	35	N/A	INTRINSIC
Pfam:Peptidase_M16	68	215	6.1e-59	PFAM
Pfam:Peptidase_M16_C	220	404	4.1e-39	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000149648

SMART Domains

Protein: ENSMUSP00000119619
Gene: ENSMUSG00000029017

Domain	Start	End	E-Value	Type
Pfam:Peptidase_M16	1	50	2.5e-19	PFAM

Coding Region Coverage

1x: 92.8%
3x: 90.6%
10x: 84.7%
20x: 71.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the peptidase M16 family and encodes a protein with a zinc-binding motif. This protein is located in the mitochondrial matrix and catalyzes the cleavage of the leader peptides of precursor proteins newly imported into the mitochondria, though it only functions as part of a heterodimeric complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruptin exhibit embryonic lethality at E8. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abtb2	T	A	2: 103,717,192	C970*	probably null	Het
Adgrv1	G	A	13: 81,559,352	P1312S	probably damaging	Het
Als2cr12	T	A	1: 58,659,099	I348F	probably benign	Het
Arid5a	T	C	1: 36,317,625	I116T	probably damaging	Het
Bank1	C	A	3: 136,100,419	D485Y	probably damaging	Het
Cbln3	C	T	14: 55,883,499	V122M	probably damaging	Het
Cox10	C	T	11: 63,964,216	C413Y	possibly damaging	Het
Ctsll3	T	A	13: 60,801,009	D44V	probably benign	Het
Cuzd1	A	T	7: 131,309,800	N483K	possibly damaging	Het
Dcaf4	G	A	12: 83,534,011		probably null	Het
Ddx60	A	G	8: 61,958,113	T470A	probably benign	Het
Dennd1b	T	C	1: 139,040,004	V44A	probably benign	Het
Dusp16	C	A	6: 134,739,883	V154F	possibly damaging	Het
Ect2	G	A	3: 27,126,948	R586*	probably null	Het
Ermard	T	A	17: 15,058,822	C460*	probably null	Het
Fat2	C	T	11: 55,256,110	G4020D	possibly damaging	Het
Galnt16	G	T	12: 80,592,417	E402*	probably null	Het
Gm5414	T	G	15: 101,625,823	D282A	probably damaging	Het
Gm6741	C	T	17: 91,236,916	Q36*	probably null	Het
Gm7356	A	T	17: 14,001,458	L103Q	probably damaging	Het
Hcn1	A	G	13: 117,975,875	T792A	possibly damaging	Het
Hemgn	T	C	4: 46,395,863	N458D	probably benign	Het
Hesx1	C	A	14: 27,001,881	D140E	probably benign	Het
Hfe2	A	T	3: 96,528,497	D357V	probably damaging	Het
Hmgcr	A	G	13: 96,663,097	I163T	possibly damaging	Het
Igfbpl1	T	C	4: 45,813,469	T249A	possibly damaging	Het
Il33	A	T	19: 29,952,739	H78L	probably benign	Het
Inpp4b	A	T	8: 82,041,935	D691V	probably damaging	Het
Itpr2	T	A	6: 146,229,871	N1945I	probably damaging	Het
Lnpep	A	G	17: 17,579,027	V122A	probably benign	Het
Lrp2	T	C	2: 69,475,403	D2938G	probably damaging	Het
Lrrc8c	A	T	5: 105,608,537	Y726F	probably benign	Het
Magi3	G	T	3: 104,015,526	Q1292K	probably benign	Het
Mllt3	A	C	4: 87,774,087	F546L	probably damaging	Het
Mrpl14	A	G	17: 45,698,221	K82R	probably benign	Het
Noxred1	A	G	12: 87,224,879	V172A	possibly damaging	Het
Obscn	A	T	11: 59,133,122	I574N	probably damaging	Het
Olfr133	A	G	17: 38,149,169	T194A	probably benign	Het
Olfr175-ps1	T	A	16: 58,824,308	T134S	probably benign	Het
Osbpl11	T	A	16: 33,234,494	V649D	probably benign	Het
Pdlim2	G	T	14: 70,166,130	P278T	probably benign	Het
Pm20d2	A	C	4: 33,183,152	L223V	probably damaging	Het
Pole2	A	T	12: 69,209,985	Y255*	probably null	Het
Rims1	T	A	1: 22,397,460	I317L		Het
Scnn1g	C	A	7: 121,742,331	H239N	probably benign	Het
Spag17	A	G	3: 100,103,110		probably null	Het
Tenm3	A	T	8: 48,293,657	F1038I	probably damaging	Het
Tshz2	T	C	2: 169,886,051	F856L	probably damaging	Het
Ubtf	A	G	11: 102,306,682	S715P	unknown	Het
Usp13	A	C	3: 32,905,430	S557R	probably damaging	Het
Usp19	T	A	9: 108,492,970	S43T	probably benign	Het
Vmn2r7	A	T	3: 64,715,976	Y308N	probably benign	Het
Zfp455	A	G	13: 67,198,621	D32G	probably damaging	Het
Zfp512	T	A	5: 31,476,881		probably null	Het
Zfr	A	G	15: 12,166,158	E838G	possibly damaging	Het

Other mutations in Pmpcb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01146:Pmpcb	APN	5	21740478	splice site	probably benign
IGL02123:Pmpcb	APN	5	21743375	unclassified	probably benign
IGL03271:Pmpcb	APN	5	21738876	missense	probably benign
PIT4651001:Pmpcb	UTSW	5	21746050	missense	probably benign	0.00
R0104:Pmpcb	UTSW	5	21746038	nonsense	probably null
R0157:Pmpcb	UTSW	5	21742952	missense	probably damaging	1.00
R0374:Pmpcb	UTSW	5	21748831	missense	probably damaging	1.00
R0842:Pmpcb	UTSW	5	21748774	missense	possibly damaging	0.95
R4868:Pmpcb	UTSW	5	21748853	nonsense	probably null
R4888:Pmpcb	UTSW	5	21740662	intron	probably benign
R4970:Pmpcb	UTSW	5	21756443	missense	probably damaging	1.00
R5112:Pmpcb	UTSW	5	21756443	missense	probably damaging	1.00
R5618:Pmpcb	UTSW	5	21742788	missense	possibly damaging	0.73
R5658:Pmpcb	UTSW	5	21739001	missense	probably damaging	0.99
R5875:Pmpcb	UTSW	5	21742946	missense	probably benign	0.04
R6150:Pmpcb	UTSW	5	21737139	splice site	probably null
R6175:Pmpcb	UTSW	5	21757033	missense	probably benign
R7201:Pmpcb	UTSW	5	21737179	start codon destroyed	probably null	0.02
R7450:Pmpcb	UTSW	5	21746985	missense	possibly damaging	0.46
R7764:Pmpcb	UTSW	5	21743452	missense	probably damaging	1.00
R8247:Pmpcb	UTSW	5	21756854	missense	probably damaging	1.00
R8794:Pmpcb	UTSW	5	21756834	missense	probably benign	0.41

Predicted Primers

PCR Primer
(F):5'- ATACAGTGTGTGAAGATCTGTGC -3'
(R):5'- TAACTCCCGTGTGGACATTTACAC -3'

Sequencing Primer
(F):5'- GTGCTGCTTATTTCTGTTAAAGACAC -3'
(R):5'- CCGTGTGGACATTTACACTCTGAG -3'

Posted On

2019-06-07