Incidental Mutation 'PIT4504001:Pmpcb'
ID 556004
Institutional Source Beutler Lab
Gene Symbol Pmpcb
Ensembl Gene ENSMUSG00000029017
Gene Name peptidase (mitochondrial processing) beta
Synonyms MPPP52, MPP11, 3110004O18Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # PIT4504001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 21737141-21757152 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 21743390 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 223 (R223L)
Ref Sequence ENSEMBL: ENSMUSP00000030882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030882] [ENSMUST00000149648]
AlphaFold Q9CXT8
Predicted Effect probably damaging
Transcript: ENSMUST00000030882
AA Change: R223L

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030882
Gene: ENSMUSG00000029017
AA Change: R223L

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
Pfam:Peptidase_M16 68 215 6.1e-59 PFAM
Pfam:Peptidase_M16_C 220 404 4.1e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149648
SMART Domains Protein: ENSMUSP00000119619
Gene: ENSMUSG00000029017

DomainStartEndE-ValueType
Pfam:Peptidase_M16 1 50 2.5e-19 PFAM
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.6%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the peptidase M16 family and encodes a protein with a zinc-binding motif. This protein is located in the mitochondrial matrix and catalyzes the cleavage of the leader peptides of precursor proteins newly imported into the mitochondria, though it only functions as part of a heterodimeric complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruptin exhibit embryonic lethality at E8. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T A 2: 103,717,192 C970* probably null Het
Adgrv1 G A 13: 81,559,352 P1312S probably damaging Het
Als2cr12 T A 1: 58,659,099 I348F probably benign Het
Arid5a T C 1: 36,317,625 I116T probably damaging Het
Bank1 C A 3: 136,100,419 D485Y probably damaging Het
Cbln3 C T 14: 55,883,499 V122M probably damaging Het
Cox10 C T 11: 63,964,216 C413Y possibly damaging Het
Ctsll3 T A 13: 60,801,009 D44V probably benign Het
Cuzd1 A T 7: 131,309,800 N483K possibly damaging Het
Dcaf4 G A 12: 83,534,011 probably null Het
Ddx60 A G 8: 61,958,113 T470A probably benign Het
Dennd1b T C 1: 139,040,004 V44A probably benign Het
Dusp16 C A 6: 134,739,883 V154F possibly damaging Het
Ect2 G A 3: 27,126,948 R586* probably null Het
Ermard T A 17: 15,058,822 C460* probably null Het
Fat2 C T 11: 55,256,110 G4020D possibly damaging Het
Galnt16 G T 12: 80,592,417 E402* probably null Het
Gm5414 T G 15: 101,625,823 D282A probably damaging Het
Gm6741 C T 17: 91,236,916 Q36* probably null Het
Gm7356 A T 17: 14,001,458 L103Q probably damaging Het
Hcn1 A G 13: 117,975,875 T792A possibly damaging Het
Hemgn T C 4: 46,395,863 N458D probably benign Het
Hesx1 C A 14: 27,001,881 D140E probably benign Het
Hfe2 A T 3: 96,528,497 D357V probably damaging Het
Hmgcr A G 13: 96,663,097 I163T possibly damaging Het
Igfbpl1 T C 4: 45,813,469 T249A possibly damaging Het
Il33 A T 19: 29,952,739 H78L probably benign Het
Inpp4b A T 8: 82,041,935 D691V probably damaging Het
Itpr2 T A 6: 146,229,871 N1945I probably damaging Het
Lnpep A G 17: 17,579,027 V122A probably benign Het
Lrp2 T C 2: 69,475,403 D2938G probably damaging Het
Lrrc8c A T 5: 105,608,537 Y726F probably benign Het
Magi3 G T 3: 104,015,526 Q1292K probably benign Het
Mllt3 A C 4: 87,774,087 F546L probably damaging Het
Mrpl14 A G 17: 45,698,221 K82R probably benign Het
Noxred1 A G 12: 87,224,879 V172A possibly damaging Het
Obscn A T 11: 59,133,122 I574N probably damaging Het
Olfr133 A G 17: 38,149,169 T194A probably benign Het
Olfr175-ps1 T A 16: 58,824,308 T134S probably benign Het
Osbpl11 T A 16: 33,234,494 V649D probably benign Het
Pdlim2 G T 14: 70,166,130 P278T probably benign Het
Pm20d2 A C 4: 33,183,152 L223V probably damaging Het
Pole2 A T 12: 69,209,985 Y255* probably null Het
Rims1 T A 1: 22,397,460 I317L Het
Scnn1g C A 7: 121,742,331 H239N probably benign Het
Spag17 A G 3: 100,103,110 probably null Het
Tenm3 A T 8: 48,293,657 F1038I probably damaging Het
Tshz2 T C 2: 169,886,051 F856L probably damaging Het
Ubtf A G 11: 102,306,682 S715P unknown Het
Usp13 A C 3: 32,905,430 S557R probably damaging Het
Usp19 T A 9: 108,492,970 S43T probably benign Het
Vmn2r7 A T 3: 64,715,976 Y308N probably benign Het
Zfp455 A G 13: 67,198,621 D32G probably damaging Het
Zfp512 T A 5: 31,476,881 probably null Het
Zfr A G 15: 12,166,158 E838G possibly damaging Het
Other mutations in Pmpcb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Pmpcb APN 5 21740478 splice site probably benign
IGL02123:Pmpcb APN 5 21743375 unclassified probably benign
IGL03271:Pmpcb APN 5 21738876 missense probably benign
PIT4651001:Pmpcb UTSW 5 21746050 missense probably benign 0.00
R0104:Pmpcb UTSW 5 21746038 nonsense probably null
R0157:Pmpcb UTSW 5 21742952 missense probably damaging 1.00
R0374:Pmpcb UTSW 5 21748831 missense probably damaging 1.00
R0842:Pmpcb UTSW 5 21748774 missense possibly damaging 0.95
R4868:Pmpcb UTSW 5 21748853 nonsense probably null
R4888:Pmpcb UTSW 5 21740662 intron probably benign
R4970:Pmpcb UTSW 5 21756443 missense probably damaging 1.00
R5112:Pmpcb UTSW 5 21756443 missense probably damaging 1.00
R5618:Pmpcb UTSW 5 21742788 missense possibly damaging 0.73
R5658:Pmpcb UTSW 5 21739001 missense probably damaging 0.99
R5875:Pmpcb UTSW 5 21742946 missense probably benign 0.04
R6150:Pmpcb UTSW 5 21737139 splice site probably null
R6175:Pmpcb UTSW 5 21757033 missense probably benign
R7201:Pmpcb UTSW 5 21737179 start codon destroyed probably null 0.02
R7450:Pmpcb UTSW 5 21746985 missense possibly damaging 0.46
R7764:Pmpcb UTSW 5 21743452 missense probably damaging 1.00
R8247:Pmpcb UTSW 5 21756854 missense probably damaging 1.00
R8794:Pmpcb UTSW 5 21756834 missense probably benign 0.41
R9116:Pmpcb UTSW 5 21756610 missense probably damaging 1.00
R9290:Pmpcb UTSW 5 21739011 critical splice donor site probably null
R9390:Pmpcb UTSW 5 21748812 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACAGTGTGTGAAGATCTGTGC -3'
(R):5'- TAACTCCCGTGTGGACATTTACAC -3'

Sequencing Primer
(F):5'- GTGCTGCTTATTTCTGTTAAAGACAC -3'
(R):5'- CCGTGTGGACATTTACACTCTGAG -3'
Posted On 2019-06-07