Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4504001:Lrrc8c'

556006

Institutional Source

Beutler Lab

Gene Symbol

Lrrc8c

Ensembl Gene

ENSMUSG00000054720

Gene Name

leucine rich repeat containing 8 family, member C

Synonyms

E430036I04Rik

Accession Numbers

NCBI RefSeq: NM_133897.2; MGI:2140839

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

PIT4504001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

105519388-105613018 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 105608537 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 726 (Y726F)

Ref Sequence

ENSEMBL: ENSMUSP00000066015 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067924] [ENSMUST00000153754]

AlphaFold

Q8R502

Predicted Effect

probably benign
Transcript: ENSMUST00000067924
AA Change: Y726F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000066015
Gene: ENSMUSG00000054720
AA Change: Y726F

Domain	Start	End	E-Value	Type
Pfam:Pannexin_like	1	338	5.7e-152	PFAM
low complexity region	398	407	N/A	INTRINSIC
LRR	588	611	3.97e0	SMART
LRR	613	635	1.81e2	SMART
LRR	636	658	2.2e1	SMART
LRR_TYP	659	682	1.45e-2	SMART
LRR	684	703	3.56e2	SMART
LRR	705	728	2.92e1	SMART
LRR	751	774	1.09e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000153754

SMART Domains

Protein: ENSMUSP00000114899
Gene: ENSMUSG00000054720

Domain	Start	End	E-Value	Type
Pfam:DUF3733	1	65	4.8e-35	PFAM
low complexity region	78	93	N/A	INTRINSIC
Pfam:DUF3733	99	158	1.7e-26	PFAM

Coding Region Coverage

1x: 92.8%
3x: 90.6%
10x: 84.7%
20x: 71.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduction in body weight, white adipose tissue weight, and insulin resistance on a high-fat diet, indicating protection from diet-induced obesity and insulin resistance. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abtb2	T	A	2: 103,717,192	C970*	probably null	Het
Adgrv1	G	A	13: 81,559,352	P1312S	probably damaging	Het
Als2cr12	T	A	1: 58,659,099	I348F	probably benign	Het
Arid5a	T	C	1: 36,317,625	I116T	probably damaging	Het
Bank1	C	A	3: 136,100,419	D485Y	probably damaging	Het
Cbln3	C	T	14: 55,883,499	V122M	probably damaging	Het
Cox10	C	T	11: 63,964,216	C413Y	possibly damaging	Het
Ctsll3	T	A	13: 60,801,009	D44V	probably benign	Het
Cuzd1	A	T	7: 131,309,800	N483K	possibly damaging	Het
Dcaf4	G	A	12: 83,534,011		probably null	Het
Ddx60	A	G	8: 61,958,113	T470A	probably benign	Het
Dennd1b	T	C	1: 139,040,004	V44A	probably benign	Het
Dusp16	C	A	6: 134,739,883	V154F	possibly damaging	Het
Ect2	G	A	3: 27,126,948	R586*	probably null	Het
Ermard	T	A	17: 15,058,822	C460*	probably null	Het
Fat2	C	T	11: 55,256,110	G4020D	possibly damaging	Het
Galnt16	G	T	12: 80,592,417	E402*	probably null	Het
Gm5414	T	G	15: 101,625,823	D282A	probably damaging	Het
Gm6741	C	T	17: 91,236,916	Q36*	probably null	Het
Gm7356	A	T	17: 14,001,458	L103Q	probably damaging	Het
Hcn1	A	G	13: 117,975,875	T792A	possibly damaging	Het
Hemgn	T	C	4: 46,395,863	N458D	probably benign	Het
Hesx1	C	A	14: 27,001,881	D140E	probably benign	Het
Hfe2	A	T	3: 96,528,497	D357V	probably damaging	Het
Hmgcr	A	G	13: 96,663,097	I163T	possibly damaging	Het
Igfbpl1	T	C	4: 45,813,469	T249A	possibly damaging	Het
Il33	A	T	19: 29,952,739	H78L	probably benign	Het
Inpp4b	A	T	8: 82,041,935	D691V	probably damaging	Het
Itpr2	T	A	6: 146,229,871	N1945I	probably damaging	Het
Lnpep	A	G	17: 17,579,027	V122A	probably benign	Het
Lrp2	T	C	2: 69,475,403	D2938G	probably damaging	Het
Magi3	G	T	3: 104,015,526	Q1292K	probably benign	Het
Mllt3	A	C	4: 87,774,087	F546L	probably damaging	Het
Mrpl14	A	G	17: 45,698,221	K82R	probably benign	Het
Noxred1	A	G	12: 87,224,879	V172A	possibly damaging	Het
Obscn	A	T	11: 59,133,122	I574N	probably damaging	Het
Olfr133	A	G	17: 38,149,169	T194A	probably benign	Het
Olfr175-ps1	T	A	16: 58,824,308	T134S	probably benign	Het
Osbpl11	T	A	16: 33,234,494	V649D	probably benign	Het
Pdlim2	G	T	14: 70,166,130	P278T	probably benign	Het
Pm20d2	A	C	4: 33,183,152	L223V	probably damaging	Het
Pmpcb	G	T	5: 21,743,390	R223L	probably damaging	Het
Pole2	A	T	12: 69,209,985	Y255*	probably null	Het
Rims1	T	A	1: 22,397,460	I317L		Het
Scnn1g	C	A	7: 121,742,331	H239N	probably benign	Het
Spag17	A	G	3: 100,103,110		probably null	Het
Tenm3	A	T	8: 48,293,657	F1038I	probably damaging	Het
Tshz2	T	C	2: 169,886,051	F856L	probably damaging	Het
Ubtf	A	G	11: 102,306,682	S715P	unknown	Het
Usp13	A	C	3: 32,905,430	S557R	probably damaging	Het
Usp19	T	A	9: 108,492,970	S43T	probably benign	Het
Vmn2r7	A	T	3: 64,715,976	Y308N	probably benign	Het
Zfp455	A	G	13: 67,198,621	D32G	probably damaging	Het
Zfp512	T	A	5: 31,476,881		probably null	Het
Zfr	A	G	15: 12,166,158	E838G	possibly damaging	Het

Other mutations in Lrrc8c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00538:Lrrc8c	APN	5	105607210	missense	probably damaging	0.99
IGL00736:Lrrc8c	APN	5	105607114	missense	probably damaging	1.00
IGL00822:Lrrc8c	APN	5	105608308	missense	probably benign	0.04
IGL02009:Lrrc8c	APN	5	105607391	missense	probably damaging	1.00
IGL02156:Lrrc8c	APN	5	105607493	missense	probably damaging	1.00
IGL02266:Lrrc8c	APN	5	105608248	missense	probably benign	0.30
IGL02268:Lrrc8c	APN	5	105607898	missense	probably damaging	1.00
IGL02487:Lrrc8c	APN	5	105606591	missense	probably benign
IGL02536:Lrrc8c	APN	5	105607172	missense	probably benign	0.00
IGL02672:Lrrc8c	APN	5	105607358	missense	possibly damaging	0.85
IGL02860:Lrrc8c	APN	5	105579615	splice site	probably benign
IGL03395:Lrrc8c	APN	5	105606629	missense	probably benign
Hand_grenade	UTSW	5	105607088	missense	probably damaging	1.00
Horseshoe	UTSW	5	105607622	missense	probably damaging	1.00
P0014:Lrrc8c	UTSW	5	105607244	missense	probably benign	0.06
PIT4651001:Lrrc8c	UTSW	5	105608323	missense	probably benign	0.04
R0196:Lrrc8c	UTSW	5	105606770	missense	probably benign	0.18
R0454:Lrrc8c	UTSW	5	105607099	missense	probably damaging	1.00
R0565:Lrrc8c	UTSW	5	105607028	missense	probably damaging	0.98
R0673:Lrrc8c	UTSW	5	105607678	missense	probably damaging	0.99
R0722:Lrrc8c	UTSW	5	105579548	missense	probably damaging	1.00
R0815:Lrrc8c	UTSW	5	105608534	missense	probably damaging	1.00
R1177:Lrrc8c	UTSW	5	105606836	missense	probably benign	0.40
R1411:Lrrc8c	UTSW	5	105608179	missense	probably damaging	0.96
R1486:Lrrc8c	UTSW	5	105607529	missense	probably damaging	1.00
R1551:Lrrc8c	UTSW	5	105608224	missense	probably damaging	1.00
R1662:Lrrc8c	UTSW	5	105606757	missense	probably benign	0.22
R1714:Lrrc8c	UTSW	5	105607291	missense	possibly damaging	0.93
R1770:Lrrc8c	UTSW	5	105606737	missense	probably damaging	1.00
R2104:Lrrc8c	UTSW	5	105607358	missense	possibly damaging	0.85
R2139:Lrrc8c	UTSW	5	105606692	missense	probably damaging	1.00
R4425:Lrrc8c	UTSW	5	105607889	missense	probably benign	0.22
R4670:Lrrc8c	UTSW	5	105608374	missense	probably benign
R4897:Lrrc8c	UTSW	5	105608089	missense	probably benign	0.01
R4968:Lrrc8c	UTSW	5	105607127	missense	probably damaging	1.00
R5114:Lrrc8c	UTSW	5	105607483	missense	probably damaging	1.00
R5580:Lrrc8c	UTSW	5	105607687	missense	probably benign	0.00
R5804:Lrrc8c	UTSW	5	105579557	missense	possibly damaging	0.88
R5918:Lrrc8c	UTSW	5	105608251	missense	possibly damaging	0.68
R6293:Lrrc8c	UTSW	5	105606746	missense	probably damaging	1.00
R6303:Lrrc8c	UTSW	5	105608609	missense	probably benign	0.31
R6304:Lrrc8c	UTSW	5	105608609	missense	probably benign	0.31
R7271:Lrrc8c	UTSW	5	105607987	missense	probably benign	0.02
R7341:Lrrc8c	UTSW	5	105607267	missense	probably damaging	1.00
R7380:Lrrc8c	UTSW	5	105607835	missense	possibly damaging	0.71
R7630:Lrrc8c	UTSW	5	105607702	missense	probably damaging	0.99
R7789:Lrrc8c	UTSW	5	105607200	missense	probably damaging	1.00
R8128:Lrrc8c	UTSW	5	105607622	missense	probably damaging	1.00
R8229:Lrrc8c	UTSW	5	105606536	missense	probably benign	0.00
R8247:Lrrc8c	UTSW	5	105608444	missense	probably damaging	1.00
R8248:Lrrc8c	UTSW	5	105607867	missense	probably benign
R8890:Lrrc8c	UTSW	5	105607088	missense	probably damaging	1.00
R9254:Lrrc8c	UTSW	5	105608490	nonsense	probably null
R9379:Lrrc8c	UTSW	5	105608490	nonsense	probably null
R9416:Lrrc8c	UTSW	5	105608297	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- AAACTGACCAGCCTGGAGAG -3'
(R):5'- CAGAGTCTCAAACAGAGCATCTTC -3'

Sequencing Primer
(F):5'- ACCAGCCTGGAGAGACTGTTTTTC -3'
(R):5'- TCTTCCACAACTAGCCCGG -3'

Posted On

2019-06-07