Incidental Mutation 'PIT4504001:Lrrc8c'
ID 556006
Institutional Source Beutler Lab
Gene Symbol Lrrc8c
Ensembl Gene ENSMUSG00000054720
Gene Name leucine rich repeat containing 8 family, member C
Synonyms E430036I04Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # PIT4504001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 105667254-105760884 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 105756403 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 726 (Y726F)
Ref Sequence ENSEMBL: ENSMUSP00000066015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067924] [ENSMUST00000153754]
AlphaFold Q8R502
Predicted Effect probably benign
Transcript: ENSMUST00000067924
AA Change: Y726F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000066015
Gene: ENSMUSG00000054720
AA Change: Y726F

DomainStartEndE-ValueType
Pfam:Pannexin_like 1 338 5.7e-152 PFAM
low complexity region 398 407 N/A INTRINSIC
LRR 588 611 3.97e0 SMART
LRR 613 635 1.81e2 SMART
LRR 636 658 2.2e1 SMART
LRR_TYP 659 682 1.45e-2 SMART
LRR 684 703 3.56e2 SMART
LRR 705 728 2.92e1 SMART
LRR 751 774 1.09e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153754
SMART Domains Protein: ENSMUSP00000114899
Gene: ENSMUSG00000054720

DomainStartEndE-ValueType
Pfam:DUF3733 1 65 4.8e-35 PFAM
low complexity region 78 93 N/A INTRINSIC
Pfam:DUF3733 99 158 1.7e-26 PFAM
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.6%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduction in body weight, white adipose tissue weight, and insulin resistance on a high-fat diet, indicating protection from diet-induced obesity and insulin resistance. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T A 2: 103,547,537 (GRCm39) C970* probably null Het
Adgrv1 G A 13: 81,707,471 (GRCm39) P1312S probably damaging Het
Arid5a T C 1: 36,356,706 (GRCm39) I116T probably damaging Het
Bank1 C A 3: 135,806,180 (GRCm39) D485Y probably damaging Het
Cbln3 C T 14: 56,120,956 (GRCm39) V122M probably damaging Het
Cox10 C T 11: 63,855,042 (GRCm39) C413Y possibly damaging Het
Ctsll3 T A 13: 60,948,823 (GRCm39) D44V probably benign Het
Cuzd1 A T 7: 130,911,529 (GRCm39) N483K possibly damaging Het
Dcaf4 G A 12: 83,580,785 (GRCm39) probably null Het
Ddx60 A G 8: 62,411,147 (GRCm39) T470A probably benign Het
Dennd1b T C 1: 138,967,742 (GRCm39) V44A probably benign Het
Dusp16 C A 6: 134,716,846 (GRCm39) V154F possibly damaging Het
Ect2 G A 3: 27,181,097 (GRCm39) R586* probably null Het
Ermard T A 17: 15,279,084 (GRCm39) C460* probably null Het
Fat2 C T 11: 55,146,936 (GRCm39) G4020D possibly damaging Het
Flacc1 T A 1: 58,698,258 (GRCm39) I348F probably benign Het
Galnt16 G T 12: 80,639,191 (GRCm39) E402* probably null Het
Gm5414 T G 15: 101,534,258 (GRCm39) D282A probably damaging Het
Gm6741 C T 17: 91,544,344 (GRCm39) Q36* probably null Het
Gm7356 A T 17: 14,221,720 (GRCm39) L103Q probably damaging Het
Hcn1 A G 13: 118,112,411 (GRCm39) T792A possibly damaging Het
Hemgn T C 4: 46,395,863 (GRCm39) N458D probably benign Het
Hesx1 C A 14: 26,723,838 (GRCm39) D140E probably benign Het
Hjv A T 3: 96,435,813 (GRCm39) D357V probably damaging Het
Hmgcr A G 13: 96,799,605 (GRCm39) I163T possibly damaging Het
Igfbpl1 T C 4: 45,813,469 (GRCm39) T249A possibly damaging Het
Il33 A T 19: 29,930,139 (GRCm39) H78L probably benign Het
Inpp4b A T 8: 82,768,564 (GRCm39) D691V probably damaging Het
Itpr2 T A 6: 146,131,369 (GRCm39) N1945I probably damaging Het
Lnpep A G 17: 17,799,289 (GRCm39) V122A probably benign Het
Lrp2 T C 2: 69,305,747 (GRCm39) D2938G probably damaging Het
Magi3 G T 3: 103,922,842 (GRCm39) Q1292K probably benign Het
Mllt3 A C 4: 87,692,324 (GRCm39) F546L probably damaging Het
Mrpl14 A G 17: 46,009,147 (GRCm39) K82R probably benign Het
Noxred1 A G 12: 87,271,653 (GRCm39) V172A possibly damaging Het
Obscn A T 11: 59,023,948 (GRCm39) I574N probably damaging Het
Or2n1b A G 17: 38,460,060 (GRCm39) T194A probably benign Het
Or5k8 T A 16: 58,644,671 (GRCm39) T134S probably benign Het
Osbpl11 T A 16: 33,054,864 (GRCm39) V649D probably benign Het
Pdlim2 G T 14: 70,403,579 (GRCm39) P278T probably benign Het
Pm20d2 A C 4: 33,183,152 (GRCm39) L223V probably damaging Het
Pmpcb G T 5: 21,948,388 (GRCm39) R223L probably damaging Het
Pole2 A T 12: 69,256,759 (GRCm39) Y255* probably null Het
Rims1 T A 1: 22,467,684 (GRCm39) I317L Het
Scnn1g C A 7: 121,341,554 (GRCm39) H239N probably benign Het
Spag17 A G 3: 100,010,426 (GRCm39) probably null Het
Tenm3 A T 8: 48,746,692 (GRCm39) F1038I probably damaging Het
Tshz2 T C 2: 169,727,971 (GRCm39) F856L probably damaging Het
Ubtf A G 11: 102,197,508 (GRCm39) S715P unknown Het
Usp13 A C 3: 32,959,579 (GRCm39) S557R probably damaging Het
Usp19 T A 9: 108,370,169 (GRCm39) S43T probably benign Het
Vmn2r7 A T 3: 64,623,397 (GRCm39) Y308N probably benign Het
Zfp455 A G 13: 67,346,685 (GRCm39) D32G probably damaging Het
Zfp512 T A 5: 31,634,225 (GRCm39) probably null Het
Zfr A G 15: 12,166,244 (GRCm39) E838G possibly damaging Het
Other mutations in Lrrc8c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Lrrc8c APN 5 105,755,076 (GRCm39) missense probably damaging 0.99
IGL00736:Lrrc8c APN 5 105,754,980 (GRCm39) missense probably damaging 1.00
IGL00822:Lrrc8c APN 5 105,756,174 (GRCm39) missense probably benign 0.04
IGL02009:Lrrc8c APN 5 105,755,257 (GRCm39) missense probably damaging 1.00
IGL02156:Lrrc8c APN 5 105,755,359 (GRCm39) missense probably damaging 1.00
IGL02266:Lrrc8c APN 5 105,756,114 (GRCm39) missense probably benign 0.30
IGL02268:Lrrc8c APN 5 105,755,764 (GRCm39) missense probably damaging 1.00
IGL02487:Lrrc8c APN 5 105,754,457 (GRCm39) missense probably benign
IGL02536:Lrrc8c APN 5 105,755,038 (GRCm39) missense probably benign 0.00
IGL02672:Lrrc8c APN 5 105,755,224 (GRCm39) missense possibly damaging 0.85
IGL02860:Lrrc8c APN 5 105,727,481 (GRCm39) splice site probably benign
IGL03395:Lrrc8c APN 5 105,754,495 (GRCm39) missense probably benign
Hand_grenade UTSW 5 105,754,954 (GRCm39) missense probably damaging 1.00
Horseshoe UTSW 5 105,755,488 (GRCm39) missense probably damaging 1.00
P0014:Lrrc8c UTSW 5 105,755,110 (GRCm39) missense probably benign 0.06
PIT4651001:Lrrc8c UTSW 5 105,756,189 (GRCm39) missense probably benign 0.04
R0196:Lrrc8c UTSW 5 105,754,636 (GRCm39) missense probably benign 0.18
R0454:Lrrc8c UTSW 5 105,754,965 (GRCm39) missense probably damaging 1.00
R0565:Lrrc8c UTSW 5 105,754,894 (GRCm39) missense probably damaging 0.98
R0673:Lrrc8c UTSW 5 105,755,544 (GRCm39) missense probably damaging 0.99
R0722:Lrrc8c UTSW 5 105,727,414 (GRCm39) missense probably damaging 1.00
R0815:Lrrc8c UTSW 5 105,756,400 (GRCm39) missense probably damaging 1.00
R1177:Lrrc8c UTSW 5 105,754,702 (GRCm39) missense probably benign 0.40
R1411:Lrrc8c UTSW 5 105,756,045 (GRCm39) missense probably damaging 0.96
R1486:Lrrc8c UTSW 5 105,755,395 (GRCm39) missense probably damaging 1.00
R1551:Lrrc8c UTSW 5 105,756,090 (GRCm39) missense probably damaging 1.00
R1662:Lrrc8c UTSW 5 105,754,623 (GRCm39) missense probably benign 0.22
R1714:Lrrc8c UTSW 5 105,755,157 (GRCm39) missense possibly damaging 0.93
R1770:Lrrc8c UTSW 5 105,754,603 (GRCm39) missense probably damaging 1.00
R2104:Lrrc8c UTSW 5 105,755,224 (GRCm39) missense possibly damaging 0.85
R2139:Lrrc8c UTSW 5 105,754,558 (GRCm39) missense probably damaging 1.00
R4425:Lrrc8c UTSW 5 105,755,755 (GRCm39) missense probably benign 0.22
R4670:Lrrc8c UTSW 5 105,756,240 (GRCm39) missense probably benign
R4897:Lrrc8c UTSW 5 105,755,955 (GRCm39) missense probably benign 0.01
R4968:Lrrc8c UTSW 5 105,754,993 (GRCm39) missense probably damaging 1.00
R5114:Lrrc8c UTSW 5 105,755,349 (GRCm39) missense probably damaging 1.00
R5580:Lrrc8c UTSW 5 105,755,553 (GRCm39) missense probably benign 0.00
R5804:Lrrc8c UTSW 5 105,727,423 (GRCm39) missense possibly damaging 0.88
R5918:Lrrc8c UTSW 5 105,756,117 (GRCm39) missense possibly damaging 0.68
R6293:Lrrc8c UTSW 5 105,754,612 (GRCm39) missense probably damaging 1.00
R6303:Lrrc8c UTSW 5 105,756,475 (GRCm39) missense probably benign 0.31
R6304:Lrrc8c UTSW 5 105,756,475 (GRCm39) missense probably benign 0.31
R7271:Lrrc8c UTSW 5 105,755,853 (GRCm39) missense probably benign 0.02
R7341:Lrrc8c UTSW 5 105,755,133 (GRCm39) missense probably damaging 1.00
R7380:Lrrc8c UTSW 5 105,755,701 (GRCm39) missense possibly damaging 0.71
R7630:Lrrc8c UTSW 5 105,755,568 (GRCm39) missense probably damaging 0.99
R7789:Lrrc8c UTSW 5 105,755,066 (GRCm39) missense probably damaging 1.00
R8128:Lrrc8c UTSW 5 105,755,488 (GRCm39) missense probably damaging 1.00
R8229:Lrrc8c UTSW 5 105,754,402 (GRCm39) missense probably benign 0.00
R8247:Lrrc8c UTSW 5 105,756,310 (GRCm39) missense probably damaging 1.00
R8248:Lrrc8c UTSW 5 105,755,733 (GRCm39) missense probably benign
R8890:Lrrc8c UTSW 5 105,754,954 (GRCm39) missense probably damaging 1.00
R9254:Lrrc8c UTSW 5 105,756,356 (GRCm39) nonsense probably null
R9379:Lrrc8c UTSW 5 105,756,356 (GRCm39) nonsense probably null
R9416:Lrrc8c UTSW 5 105,756,163 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AAACTGACCAGCCTGGAGAG -3'
(R):5'- CAGAGTCTCAAACAGAGCATCTTC -3'

Sequencing Primer
(F):5'- ACCAGCCTGGAGAGACTGTTTTTC -3'
(R):5'- TCTTCCACAACTAGCCCGG -3'
Posted On 2019-06-07