Incidental Mutation 'PIT4504001:Scnn1g'
ID 556009
Institutional Source Beutler Lab
Gene Symbol Scnn1g
Ensembl Gene ENSMUSG00000000216
Gene Name sodium channel, nonvoltage-gated 1 gamma
Synonyms ENaC gamma
Accession Numbers
Essential gene? Possibly essential (E-score: 0.591) question?
Stock # PIT4504001 (G1)
Quality Score 160.009
Status Not validated
Chromosome 7
Chromosomal Location 121333702-121367698 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 121341554 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 239 (H239N)
Ref Sequence ENSEMBL: ENSMUSP00000000221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000221]
AlphaFold Q9WU39
Predicted Effect probably benign
Transcript: ENSMUST00000000221
AA Change: H239N

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000000221
Gene: ENSMUSG00000000216
AA Change: H239N

DomainStartEndE-ValueType
Pfam:ASC 32 558 6.4e-91 PFAM
low complexity region 618 631 N/A INTRINSIC
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.6%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the gamma subunit of the epithelial sodium channel, a member of the amiloride-sensitive sodium channel family of proteins. This channel regulates sodium homeostasis and blood pressure, by controlling sodium transport in the kidney, colon and lung. Proteolytic processing of the encoded protein results in the release of an inhibitory peptide and channel activation. Homozygous knockout mice for this gene exhibit perinatal lethality, likely due to excess serum potassium. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in partial lethality between 24-36 hours after birth. Newborns exhibit hyperkalemia, clear lung liquid more slowly, and show low urinary potassium and high urinary sodium concentrations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T A 2: 103,547,537 (GRCm39) C970* probably null Het
Adgrv1 G A 13: 81,707,471 (GRCm39) P1312S probably damaging Het
Arid5a T C 1: 36,356,706 (GRCm39) I116T probably damaging Het
Bank1 C A 3: 135,806,180 (GRCm39) D485Y probably damaging Het
Cbln3 C T 14: 56,120,956 (GRCm39) V122M probably damaging Het
Cox10 C T 11: 63,855,042 (GRCm39) C413Y possibly damaging Het
Ctsll3 T A 13: 60,948,823 (GRCm39) D44V probably benign Het
Cuzd1 A T 7: 130,911,529 (GRCm39) N483K possibly damaging Het
Dcaf4 G A 12: 83,580,785 (GRCm39) probably null Het
Ddx60 A G 8: 62,411,147 (GRCm39) T470A probably benign Het
Dennd1b T C 1: 138,967,742 (GRCm39) V44A probably benign Het
Dusp16 C A 6: 134,716,846 (GRCm39) V154F possibly damaging Het
Ect2 G A 3: 27,181,097 (GRCm39) R586* probably null Het
Ermard T A 17: 15,279,084 (GRCm39) C460* probably null Het
Fat2 C T 11: 55,146,936 (GRCm39) G4020D possibly damaging Het
Flacc1 T A 1: 58,698,258 (GRCm39) I348F probably benign Het
Galnt16 G T 12: 80,639,191 (GRCm39) E402* probably null Het
Gm5414 T G 15: 101,534,258 (GRCm39) D282A probably damaging Het
Gm6741 C T 17: 91,544,344 (GRCm39) Q36* probably null Het
Gm7356 A T 17: 14,221,720 (GRCm39) L103Q probably damaging Het
Hcn1 A G 13: 118,112,411 (GRCm39) T792A possibly damaging Het
Hemgn T C 4: 46,395,863 (GRCm39) N458D probably benign Het
Hesx1 C A 14: 26,723,838 (GRCm39) D140E probably benign Het
Hjv A T 3: 96,435,813 (GRCm39) D357V probably damaging Het
Hmgcr A G 13: 96,799,605 (GRCm39) I163T possibly damaging Het
Igfbpl1 T C 4: 45,813,469 (GRCm39) T249A possibly damaging Het
Il33 A T 19: 29,930,139 (GRCm39) H78L probably benign Het
Inpp4b A T 8: 82,768,564 (GRCm39) D691V probably damaging Het
Itpr2 T A 6: 146,131,369 (GRCm39) N1945I probably damaging Het
Lnpep A G 17: 17,799,289 (GRCm39) V122A probably benign Het
Lrp2 T C 2: 69,305,747 (GRCm39) D2938G probably damaging Het
Lrrc8c A T 5: 105,756,403 (GRCm39) Y726F probably benign Het
Magi3 G T 3: 103,922,842 (GRCm39) Q1292K probably benign Het
Mllt3 A C 4: 87,692,324 (GRCm39) F546L probably damaging Het
Mrpl14 A G 17: 46,009,147 (GRCm39) K82R probably benign Het
Noxred1 A G 12: 87,271,653 (GRCm39) V172A possibly damaging Het
Obscn A T 11: 59,023,948 (GRCm39) I574N probably damaging Het
Or2n1b A G 17: 38,460,060 (GRCm39) T194A probably benign Het
Or5k8 T A 16: 58,644,671 (GRCm39) T134S probably benign Het
Osbpl11 T A 16: 33,054,864 (GRCm39) V649D probably benign Het
Pdlim2 G T 14: 70,403,579 (GRCm39) P278T probably benign Het
Pm20d2 A C 4: 33,183,152 (GRCm39) L223V probably damaging Het
Pmpcb G T 5: 21,948,388 (GRCm39) R223L probably damaging Het
Pole2 A T 12: 69,256,759 (GRCm39) Y255* probably null Het
Rims1 T A 1: 22,467,684 (GRCm39) I317L Het
Spag17 A G 3: 100,010,426 (GRCm39) probably null Het
Tenm3 A T 8: 48,746,692 (GRCm39) F1038I probably damaging Het
Tshz2 T C 2: 169,727,971 (GRCm39) F856L probably damaging Het
Ubtf A G 11: 102,197,508 (GRCm39) S715P unknown Het
Usp13 A C 3: 32,959,579 (GRCm39) S557R probably damaging Het
Usp19 T A 9: 108,370,169 (GRCm39) S43T probably benign Het
Vmn2r7 A T 3: 64,623,397 (GRCm39) Y308N probably benign Het
Zfp455 A G 13: 67,346,685 (GRCm39) D32G probably damaging Het
Zfp512 T A 5: 31,634,225 (GRCm39) probably null Het
Zfr A G 15: 12,166,244 (GRCm39) E838G possibly damaging Het
Other mutations in Scnn1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Scnn1g APN 7 121,339,660 (GRCm39) missense probably benign 0.00
IGL01824:Scnn1g APN 7 121,365,516 (GRCm39) missense probably benign 0.00
IGL02133:Scnn1g APN 7 121,342,922 (GRCm39) missense probably damaging 1.00
IGL02529:Scnn1g APN 7 121,341,669 (GRCm39) splice site probably benign
IGL02814:Scnn1g APN 7 121,339,588 (GRCm39) missense probably damaging 1.00
IGL03091:Scnn1g APN 7 121,345,906 (GRCm39) missense probably damaging 1.00
IGL03253:Scnn1g APN 7 121,337,156 (GRCm39) nonsense probably null
R0230:Scnn1g UTSW 7 121,345,984 (GRCm39) splice site probably benign
R0324:Scnn1g UTSW 7 121,339,778 (GRCm39) missense possibly damaging 0.62
R0367:Scnn1g UTSW 7 121,345,802 (GRCm39) splice site probably benign
R0534:Scnn1g UTSW 7 121,366,647 (GRCm39) missense probably benign 0.00
R1747:Scnn1g UTSW 7 121,359,686 (GRCm39) missense probably damaging 0.99
R2004:Scnn1g UTSW 7 121,337,411 (GRCm39) nonsense probably null
R2197:Scnn1g UTSW 7 121,366,519 (GRCm39) missense probably damaging 1.00
R4396:Scnn1g UTSW 7 121,339,650 (GRCm39) missense probably benign 0.01
R4804:Scnn1g UTSW 7 121,362,303 (GRCm39) frame shift probably null
R4805:Scnn1g UTSW 7 121,345,825 (GRCm39) missense probably damaging 1.00
R5219:Scnn1g UTSW 7 121,365,489 (GRCm39) missense probably damaging 1.00
R5757:Scnn1g UTSW 7 121,337,438 (GRCm39) missense probably damaging 1.00
R5882:Scnn1g UTSW 7 121,366,581 (GRCm39) missense possibly damaging 0.79
R5910:Scnn1g UTSW 7 121,337,318 (GRCm39) missense probably damaging 0.99
R6381:Scnn1g UTSW 7 121,366,722 (GRCm39) missense probably benign 0.00
R6666:Scnn1g UTSW 7 121,366,611 (GRCm39) missense probably benign 0.00
R6735:Scnn1g UTSW 7 121,341,486 (GRCm39) missense probably benign 0.02
R6813:Scnn1g UTSW 7 121,339,576 (GRCm39) missense probably damaging 1.00
R6860:Scnn1g UTSW 7 121,339,576 (GRCm39) missense probably damaging 1.00
R6887:Scnn1g UTSW 7 121,359,667 (GRCm39) missense probably benign 0.01
R7289:Scnn1g UTSW 7 121,337,304 (GRCm39) nonsense probably null
R7488:Scnn1g UTSW 7 121,362,657 (GRCm39) missense probably benign 0.00
R7630:Scnn1g UTSW 7 121,359,704 (GRCm39) missense probably damaging 1.00
R7888:Scnn1g UTSW 7 121,342,878 (GRCm39) missense probably damaging 0.97
R7917:Scnn1g UTSW 7 121,342,916 (GRCm39) missense probably damaging 1.00
R9051:Scnn1g UTSW 7 121,341,566 (GRCm39) missense possibly damaging 0.86
R9312:Scnn1g UTSW 7 121,339,818 (GRCm39) missense probably benign 0.00
Z1177:Scnn1g UTSW 7 121,359,698 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GAGAGGAAACCAATTTGTCCCC -3'
(R):5'- AAAGGGCAGAGTCAGTGTTCTC -3'

Sequencing Primer
(F):5'- CAAGGACCTACCCTGACATTTGTC -3'
(R):5'- GTCAGTGTTCTCAAAGCCTACAGG -3'
Posted On 2019-06-07