Incidental Mutation 'R0604:Polr3a'
ID55601
Institutional Source Beutler Lab
Gene Symbol Polr3a
Ensembl Gene ENSMUSG00000025280
Gene Namepolymerase (RNA) III (DNA directed) polypeptide A
SynonymsRPC1, 9330175N20Rik, RPC155
MMRRC Submission 038793-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0604 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location24448696-24487058 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24484164 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 91 (P91L)
Ref Sequence ENSEMBL: ENSMUSP00000153243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026322] [ENSMUST00000223718]
Predicted Effect probably damaging
Transcript: ENSMUST00000026322
AA Change: P91L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026322
Gene: ENSMUSG00000025280
AA Change: P91L

DomainStartEndE-ValueType
Blast:RPOLA_N 122 218 5e-43 BLAST
RPOLA_N 248 553 1.09e-176 SMART
Pfam:RNA_pol_Rpb1_4 728 834 4e-35 PFAM
Pfam:RNA_pol_Rpb1_5 841 1318 1.2e-92 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000223718
AA Change: P91L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223931
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225526
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the catalytic component of RNA polymerase III, which synthesizes small RNAs. The encoded protein also acts as a sensor to detect foreign DNA and trigger an innate immune response. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik C A 2: 28,466,091 R60L possibly damaging Het
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Acap1 T C 11: 69,884,625 E302G probably benign Het
Adrb2 G A 18: 62,178,515 T413I possibly damaging Het
Aqr T C 2: 114,130,604 K725R probably benign Het
Braf A G 6: 39,623,697 I662T probably damaging Het
Ccdc178 A G 18: 22,067,443 S435P probably benign Het
Chd9 A G 8: 91,036,542 M2332V possibly damaging Het
Clgn T C 8: 83,424,194 V496A probably benign Het
Dnah17 A C 11: 118,121,471 S193R probably benign Het
Dntt A G 19: 41,053,149 E424G probably benign Het
Fam149a A G 8: 45,345,008 L492P probably damaging Het
Fetub T C 16: 22,935,660 Y126H possibly damaging Het
Fgfr3 A T 5: 33,732,782 Y96F probably damaging Het
Gm4952 A G 19: 12,624,672 E148G probably benign Het
Gucy2g T A 19: 55,203,087 L977F probably benign Het
Il1r1 T C 1: 40,282,246 V6A probably benign Het
Itsn2 C A 12: 4,658,189 Q832K probably benign Het
Lats1 T A 10: 7,712,661 F1014Y probably damaging Het
Mcc G A 18: 44,473,756 A536V probably damaging Het
Mtrf1 T C 14: 79,415,887 V334A possibly damaging Het
Olfr1179 T C 2: 88,402,383 T184A probably benign Het
Olfr325 T A 11: 58,581,348 M168K probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr50 T A 2: 36,794,107 Y290* probably null Het
Pard6g A G 18: 80,117,208 S179G probably damaging Het
Psg27 A T 7: 18,557,072 V402D probably damaging Het
Rttn A G 18: 88,977,758 I222V probably damaging Het
Sp9 T A 2: 73,273,638 S179T probably benign Het
Tbc1d8 T A 1: 39,405,326 H184L probably damaging Het
Vmn1r69 A G 7: 10,580,654 V50A probably benign Het
Vmn2r58 A G 7: 41,860,576 F526L possibly damaging Het
Other mutations in Polr3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Polr3a APN 14 24475863 missense probably benign 0.35
IGL00974:Polr3a APN 14 24479424 missense probably benign 0.05
IGL01348:Polr3a APN 14 24461763 missense probably damaging 1.00
IGL01464:Polr3a APN 14 24470681 splice site probably benign
IGL01785:Polr3a APN 14 24484120 nonsense probably null
IGL01786:Polr3a APN 14 24484120 nonsense probably null
IGL01936:Polr3a APN 14 24479188 missense probably damaging 1.00
IGL02095:Polr3a APN 14 24454610 missense possibly damaging 0.91
IGL02454:Polr3a APN 14 24475823 missense possibly damaging 0.87
IGL02702:Polr3a APN 14 24470877 missense probably benign 0.07
IGL02961:Polr3a APN 14 24467040 nonsense probably null
IGL03069:Polr3a APN 14 24461740 missense probably damaging 0.99
R0001:Polr3a UTSW 14 24452189 splice site probably benign
R0048:Polr3a UTSW 14 24469255 splice site probably benign
R0157:Polr3a UTSW 14 24479186 missense probably damaging 0.99
R0445:Polr3a UTSW 14 24454921 missense probably benign 0.00
R0449:Polr3a UTSW 14 24484466 missense probably damaging 0.99
R0597:Polr3a UTSW 14 24484134 missense probably benign 0.29
R0644:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0703:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0754:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0767:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0816:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0817:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0819:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0840:Polr3a UTSW 14 24452200 missense possibly damaging 0.95
R1481:Polr3a UTSW 14 24452548 missense probably null 0.98
R1644:Polr3a UTSW 14 24470624 missense probably damaging 1.00
R1699:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R1704:Polr3a UTSW 14 24484120 nonsense probably null
R2363:Polr3a UTSW 14 24475892 splice site probably null
R3419:Polr3a UTSW 14 24467035 missense probably damaging 1.00
R3934:Polr3a UTSW 14 24476101 missense probably benign 0.30
R4296:Polr3a UTSW 14 24453196 missense possibly damaging 0.82
R4611:Polr3a UTSW 14 24452508 splice site probably null
R4690:Polr3a UTSW 14 24464281 missense possibly damaging 0.78
R4934:Polr3a UTSW 14 24452624 missense probably benign 0.11
R4947:Polr3a UTSW 14 24482464 missense probably benign 0.00
R5232:Polr3a UTSW 14 24453211 missense probably benign 0.00
R5263:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5264:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5265:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5282:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5319:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5321:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5323:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5387:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5388:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5401:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5402:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5443:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5444:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5725:Polr3a UTSW 14 24465387 splice site probably null
R5841:Polr3a UTSW 14 24450698 missense probably benign 0.00
R6408:Polr3a UTSW 14 24486871 critical splice donor site probably null
R6704:Polr3a UTSW 14 24461842 missense probably damaging 1.00
R7136:Polr3a UTSW 14 24461815 missense probably damaging 1.00
R7307:Polr3a UTSW 14 24459987 missense probably benign 0.03
R7368:Polr3a UTSW 14 24467076 missense probably damaging 0.98
R7800:Polr3a UTSW 14 24484387 missense probably null 0.83
Z1088:Polr3a UTSW 14 24479724 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCACGGCTTGCGATGAATAAACTAC -3'
(R):5'- TCCCAGTGTTCCACAGTTGACACG -3'

Sequencing Primer
(F):5'- agcaccaaacgccttacc -3'
(R):5'- ACGTGAAATCGTTGGTCCC -3'
Posted On2013-07-11