Incidental Mutation 'PIT4504001:Cuzd1'
ID 556010
Institutional Source Beutler Lab
Gene Symbol Cuzd1
Ensembl Gene ENSMUSG00000040205
Gene Name CUB and zona pellucida-like domains 1
Synonyms ERG-1, UTCZP, UO-44, Itmap1
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # PIT4504001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 130910283-130924021 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 130911529 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 483 (N483K)
Ref Sequence ENSEMBL: ENSMUSP00000037168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046611] [ENSMUST00000124096] [ENSMUST00000208921]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000046611
AA Change: N483K

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000037168
Gene: ENSMUSG00000040205
AA Change: N483K

DomainStartEndE-ValueType
CUB 32 146 1.78e-16 SMART
CUB 154 265 1.1e-44 SMART
ZP 276 519 1.39e-63 SMART
transmembrane domain 571 593 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208921
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.6%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Female mice homozygous for disruption of this gene exhibit impaired mammary gland development during puberty and during and following pregnancy and do not lactate. Homozygous mutant mice show an increased susceptibility to induced pancreatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T A 2: 103,547,537 (GRCm39) C970* probably null Het
Adgrv1 G A 13: 81,707,471 (GRCm39) P1312S probably damaging Het
Arid5a T C 1: 36,356,706 (GRCm39) I116T probably damaging Het
Bank1 C A 3: 135,806,180 (GRCm39) D485Y probably damaging Het
Cbln3 C T 14: 56,120,956 (GRCm39) V122M probably damaging Het
Cox10 C T 11: 63,855,042 (GRCm39) C413Y possibly damaging Het
Ctsll3 T A 13: 60,948,823 (GRCm39) D44V probably benign Het
Dcaf4 G A 12: 83,580,785 (GRCm39) probably null Het
Ddx60 A G 8: 62,411,147 (GRCm39) T470A probably benign Het
Dennd1b T C 1: 138,967,742 (GRCm39) V44A probably benign Het
Dusp16 C A 6: 134,716,846 (GRCm39) V154F possibly damaging Het
Ect2 G A 3: 27,181,097 (GRCm39) R586* probably null Het
Ermard T A 17: 15,279,084 (GRCm39) C460* probably null Het
Fat2 C T 11: 55,146,936 (GRCm39) G4020D possibly damaging Het
Flacc1 T A 1: 58,698,258 (GRCm39) I348F probably benign Het
Galnt16 G T 12: 80,639,191 (GRCm39) E402* probably null Het
Gm5414 T G 15: 101,534,258 (GRCm39) D282A probably damaging Het
Gm6741 C T 17: 91,544,344 (GRCm39) Q36* probably null Het
Gm7356 A T 17: 14,221,720 (GRCm39) L103Q probably damaging Het
Hcn1 A G 13: 118,112,411 (GRCm39) T792A possibly damaging Het
Hemgn T C 4: 46,395,863 (GRCm39) N458D probably benign Het
Hesx1 C A 14: 26,723,838 (GRCm39) D140E probably benign Het
Hjv A T 3: 96,435,813 (GRCm39) D357V probably damaging Het
Hmgcr A G 13: 96,799,605 (GRCm39) I163T possibly damaging Het
Igfbpl1 T C 4: 45,813,469 (GRCm39) T249A possibly damaging Het
Il33 A T 19: 29,930,139 (GRCm39) H78L probably benign Het
Inpp4b A T 8: 82,768,564 (GRCm39) D691V probably damaging Het
Itpr2 T A 6: 146,131,369 (GRCm39) N1945I probably damaging Het
Lnpep A G 17: 17,799,289 (GRCm39) V122A probably benign Het
Lrp2 T C 2: 69,305,747 (GRCm39) D2938G probably damaging Het
Lrrc8c A T 5: 105,756,403 (GRCm39) Y726F probably benign Het
Magi3 G T 3: 103,922,842 (GRCm39) Q1292K probably benign Het
Mllt3 A C 4: 87,692,324 (GRCm39) F546L probably damaging Het
Mrpl14 A G 17: 46,009,147 (GRCm39) K82R probably benign Het
Noxred1 A G 12: 87,271,653 (GRCm39) V172A possibly damaging Het
Obscn A T 11: 59,023,948 (GRCm39) I574N probably damaging Het
Or2n1b A G 17: 38,460,060 (GRCm39) T194A probably benign Het
Or5k8 T A 16: 58,644,671 (GRCm39) T134S probably benign Het
Osbpl11 T A 16: 33,054,864 (GRCm39) V649D probably benign Het
Pdlim2 G T 14: 70,403,579 (GRCm39) P278T probably benign Het
Pm20d2 A C 4: 33,183,152 (GRCm39) L223V probably damaging Het
Pmpcb G T 5: 21,948,388 (GRCm39) R223L probably damaging Het
Pole2 A T 12: 69,256,759 (GRCm39) Y255* probably null Het
Rims1 T A 1: 22,467,684 (GRCm39) I317L Het
Scnn1g C A 7: 121,341,554 (GRCm39) H239N probably benign Het
Spag17 A G 3: 100,010,426 (GRCm39) probably null Het
Tenm3 A T 8: 48,746,692 (GRCm39) F1038I probably damaging Het
Tshz2 T C 2: 169,727,971 (GRCm39) F856L probably damaging Het
Ubtf A G 11: 102,197,508 (GRCm39) S715P unknown Het
Usp13 A C 3: 32,959,579 (GRCm39) S557R probably damaging Het
Usp19 T A 9: 108,370,169 (GRCm39) S43T probably benign Het
Vmn2r7 A T 3: 64,623,397 (GRCm39) Y308N probably benign Het
Zfp455 A G 13: 67,346,685 (GRCm39) D32G probably damaging Het
Zfp512 T A 5: 31,634,225 (GRCm39) probably null Het
Zfr A G 15: 12,166,244 (GRCm39) E838G possibly damaging Het
Other mutations in Cuzd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Cuzd1 APN 7 130,917,865 (GRCm39) missense probably damaging 0.99
IGL01140:Cuzd1 APN 7 130,913,523 (GRCm39) missense probably damaging 1.00
IGL01773:Cuzd1 APN 7 130,916,614 (GRCm39) missense probably damaging 1.00
IGL02960:Cuzd1 APN 7 130,921,832 (GRCm39) missense probably benign 0.01
R0233:Cuzd1 UTSW 7 130,913,545 (GRCm39) missense possibly damaging 0.61
R0233:Cuzd1 UTSW 7 130,913,545 (GRCm39) missense possibly damaging 0.61
R0363:Cuzd1 UTSW 7 130,917,991 (GRCm39) missense probably benign 0.16
R0375:Cuzd1 UTSW 7 130,913,637 (GRCm39) intron probably benign
R0446:Cuzd1 UTSW 7 130,918,009 (GRCm39) splice site probably null
R0482:Cuzd1 UTSW 7 130,911,601 (GRCm39) unclassified probably benign
R0765:Cuzd1 UTSW 7 130,917,824 (GRCm39) missense probably benign 0.40
R0932:Cuzd1 UTSW 7 130,921,923 (GRCm39) intron probably benign
R1463:Cuzd1 UTSW 7 130,918,371 (GRCm39) missense probably damaging 1.00
R1533:Cuzd1 UTSW 7 130,913,432 (GRCm39) missense probably damaging 0.99
R1722:Cuzd1 UTSW 7 130,913,373 (GRCm39) missense probably damaging 0.96
R1920:Cuzd1 UTSW 7 130,911,425 (GRCm39) missense probably benign 0.00
R2027:Cuzd1 UTSW 7 130,921,820 (GRCm39) missense possibly damaging 0.93
R2039:Cuzd1 UTSW 7 130,916,643 (GRCm39) intron probably benign
R2039:Cuzd1 UTSW 7 130,911,345 (GRCm39) missense probably benign 0.00
R2857:Cuzd1 UTSW 7 130,917,863 (GRCm39) missense probably damaging 0.97
R2859:Cuzd1 UTSW 7 130,917,863 (GRCm39) missense probably damaging 0.97
R4585:Cuzd1 UTSW 7 130,916,529 (GRCm39) missense probably damaging 1.00
R4586:Cuzd1 UTSW 7 130,916,529 (GRCm39) missense probably damaging 1.00
R4830:Cuzd1 UTSW 7 130,919,783 (GRCm39) missense probably damaging 0.99
R4945:Cuzd1 UTSW 7 130,918,350 (GRCm39) missense probably damaging 1.00
R5009:Cuzd1 UTSW 7 130,913,252 (GRCm39) missense probably damaging 1.00
R5337:Cuzd1 UTSW 7 130,917,803 (GRCm39) missense probably damaging 1.00
R5355:Cuzd1 UTSW 7 130,917,853 (GRCm39) missense probably damaging 1.00
R6543:Cuzd1 UTSW 7 130,911,497 (GRCm39) missense probably damaging 1.00
R6569:Cuzd1 UTSW 7 130,913,486 (GRCm39) missense probably damaging 1.00
R6681:Cuzd1 UTSW 7 130,913,412 (GRCm39) missense probably damaging 1.00
R6818:Cuzd1 UTSW 7 130,918,394 (GRCm39) missense probably damaging 1.00
R6819:Cuzd1 UTSW 7 130,911,460 (GRCm39) missense possibly damaging 0.51
R7031:Cuzd1 UTSW 7 130,910,580 (GRCm39) missense probably benign 0.22
R7524:Cuzd1 UTSW 7 130,913,347 (GRCm39) missense probably damaging 0.97
R8328:Cuzd1 UTSW 7 130,913,345 (GRCm39) missense probably damaging 1.00
R8403:Cuzd1 UTSW 7 130,913,297 (GRCm39) missense probably damaging 1.00
R8425:Cuzd1 UTSW 7 130,919,720 (GRCm39) missense possibly damaging 0.54
R8519:Cuzd1 UTSW 7 130,910,626 (GRCm39) missense possibly damaging 0.47
R8879:Cuzd1 UTSW 7 130,910,577 (GRCm39) missense probably damaging 0.99
R8977:Cuzd1 UTSW 7 130,923,754 (GRCm39) missense probably benign 0.35
R9672:Cuzd1 UTSW 7 130,919,847 (GRCm39) missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- AGGCGAATGGGTCCTATAACAG -3'
(R):5'- TACGTTTCTCAGAACCACCC -3'

Sequencing Primer
(F):5'- GGGTCCTATAACAGAGTCAGTCTTC -3'
(R):5'- ACCCACTGGTGTTTTTCTAGAGAG -3'
Posted On 2019-06-07