Incidental Mutation 'PIT4504001:Usp19'
ID 556014
Institutional Source Beutler Lab
Gene Symbol Usp19
Ensembl Gene ENSMUSG00000006676
Gene Name ubiquitin specific peptidase 19
Synonyms 8430421I07Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.208) question?
Stock # PIT4504001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 108367806-108379536 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 108370169 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 43 (S43T)
Ref Sequence ENSEMBL: ENSMUSP00000006854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006854] [ENSMUST00000065014] [ENSMUST00000085044] [ENSMUST00000166103] [ENSMUST00000178075] [ENSMUST00000193678]
AlphaFold Q3UJD6
Predicted Effect probably benign
Transcript: ENSMUST00000006854
AA Change: S43T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000006854
Gene: ENSMUSG00000006676
AA Change: S43T

DomainStartEndE-ValueType
Pfam:CS 55 129 1.3e-6 PFAM
low complexity region 257 268 N/A INTRINSIC
Pfam:CS 326 414 7.1e-19 PFAM
Pfam:USP19_linker 415 537 2.2e-61 PFAM
Pfam:UCH 538 1253 1.2e-77 PFAM
Pfam:UCH_1 539 874 8.6e-11 PFAM
Pfam:zf-MYND 833 875 9.9e-11 PFAM
Pfam:UCH_1 1021 1235 7.1e-10 PFAM
low complexity region 1278 1287 N/A INTRINSIC
low complexity region 1301 1312 N/A INTRINSIC
transmembrane domain 1333 1355 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065014
SMART Domains Protein: ENSMUSP00000069087
Gene: ENSMUSG00000052911

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
LamNT 44 284 1.9e-102 SMART
EGF_Lam 286 347 1.34e-6 SMART
EGF_Lam 350 410 6.1e-10 SMART
EGF_Lam 413 470 2.98e-13 SMART
EGF_Lam 473 522 7.93e-9 SMART
EGF_Lam 525 569 1.01e-10 SMART
EGF_Lam 784 829 3.42e-13 SMART
EGF_Lam 832 875 6.54e-10 SMART
EGF_Lam 878 925 1.34e-6 SMART
EGF_Lam 928 984 4.74e-7 SMART
EGF_Lam 987 1036 1.53e-10 SMART
EGF_Lam 1039 1093 6.29e-12 SMART
EGF_Lam 1096 1141 1.79e-7 SMART
EGF_Lam 1144 1188 6.64e-11 SMART
coiled coil region 1261 1299 N/A INTRINSIC
low complexity region 1445 1458 N/A INTRINSIC
coiled coil region 1473 1527 N/A INTRINSIC
low complexity region 1609 1625 N/A INTRINSIC
SCOP:d1eq1a_ 1632 1786 5e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085044
AA Change: S43T

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000082119
Gene: ENSMUSG00000006676
AA Change: S43T

DomainStartEndE-ValueType
Pfam:CS 55 129 4.7e-7 PFAM
low complexity region 257 268 N/A INTRINSIC
Pfam:CS 326 414 2.5e-15 PFAM
low complexity region 449 460 N/A INTRINSIC
low complexity region 524 530 N/A INTRINSIC
Pfam:UCH 538 1253 7.4e-84 PFAM
Pfam:UCH_1 539 879 2.3e-13 PFAM
Pfam:zf-MYND 833 875 2.4e-10 PFAM
Pfam:UCH_1 1020 1235 2.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166103
AA Change: S43T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128573
Gene: ENSMUSG00000006676
AA Change: S43T

DomainStartEndE-ValueType
Pfam:CS 55 129 2.6e-7 PFAM
low complexity region 257 268 N/A INTRINSIC
Pfam:CS 326 390 3.9e-9 PFAM
low complexity region 425 436 N/A INTRINSIC
low complexity region 500 506 N/A INTRINSIC
Pfam:UCH 514 1229 1.8e-84 PFAM
Pfam:UCH_1 515 855 5.5e-14 PFAM
Pfam:zf-MYND 809 851 1.7e-10 PFAM
Pfam:UCH_1 996 1211 6.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178075
AA Change: S43T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000135930
Gene: ENSMUSG00000006676
AA Change: S43T

DomainStartEndE-ValueType
Pfam:CS 55 129 1e-6 PFAM
low complexity region 258 269 N/A INTRINSIC
Pfam:CS 327 415 5.4e-15 PFAM
low complexity region 450 461 N/A INTRINSIC
low complexity region 525 531 N/A INTRINSIC
Pfam:UCH 539 1254 4.9e-84 PFAM
Pfam:UCH_1 540 880 1.4e-13 PFAM
Pfam:zf-MYND 834 876 5.2e-10 PFAM
Pfam:UCH_1 1021 1236 1.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193558
Predicted Effect probably benign
Transcript: ENSMUST00000193678
AA Change: S43T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000141738
Gene: ENSMUSG00000006676
AA Change: S43T

DomainStartEndE-ValueType
Pfam:CS 55 129 6.8e-7 PFAM
low complexity region 258 269 N/A INTRINSIC
Pfam:CS 327 415 3.6e-15 PFAM
low complexity region 448 459 N/A INTRINSIC
low complexity region 523 529 N/A INTRINSIC
Pfam:UCH 537 1252 3.8e-84 PFAM
Pfam:UCH_1 538 878 1.1e-13 PFAM
Pfam:zf-MYND 832 874 5.1e-10 PFAM
Pfam:UCH_1 1019 1234 1.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194171
Predicted Effect probably benign
Transcript: ENSMUST00000194863
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.6%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit decreased body weight, reduced male fertility, and increased resistance to skeletal muscle atrophy induced by both glucocorticoids and denervation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T A 2: 103,547,537 (GRCm39) C970* probably null Het
Adgrv1 G A 13: 81,707,471 (GRCm39) P1312S probably damaging Het
Arid5a T C 1: 36,356,706 (GRCm39) I116T probably damaging Het
Bank1 C A 3: 135,806,180 (GRCm39) D485Y probably damaging Het
Cbln3 C T 14: 56,120,956 (GRCm39) V122M probably damaging Het
Cox10 C T 11: 63,855,042 (GRCm39) C413Y possibly damaging Het
Ctsll3 T A 13: 60,948,823 (GRCm39) D44V probably benign Het
Cuzd1 A T 7: 130,911,529 (GRCm39) N483K possibly damaging Het
Dcaf4 G A 12: 83,580,785 (GRCm39) probably null Het
Ddx60 A G 8: 62,411,147 (GRCm39) T470A probably benign Het
Dennd1b T C 1: 138,967,742 (GRCm39) V44A probably benign Het
Dusp16 C A 6: 134,716,846 (GRCm39) V154F possibly damaging Het
Ect2 G A 3: 27,181,097 (GRCm39) R586* probably null Het
Ermard T A 17: 15,279,084 (GRCm39) C460* probably null Het
Fat2 C T 11: 55,146,936 (GRCm39) G4020D possibly damaging Het
Flacc1 T A 1: 58,698,258 (GRCm39) I348F probably benign Het
Galnt16 G T 12: 80,639,191 (GRCm39) E402* probably null Het
Gm5414 T G 15: 101,534,258 (GRCm39) D282A probably damaging Het
Gm6741 C T 17: 91,544,344 (GRCm39) Q36* probably null Het
Gm7356 A T 17: 14,221,720 (GRCm39) L103Q probably damaging Het
Hcn1 A G 13: 118,112,411 (GRCm39) T792A possibly damaging Het
Hemgn T C 4: 46,395,863 (GRCm39) N458D probably benign Het
Hesx1 C A 14: 26,723,838 (GRCm39) D140E probably benign Het
Hjv A T 3: 96,435,813 (GRCm39) D357V probably damaging Het
Hmgcr A G 13: 96,799,605 (GRCm39) I163T possibly damaging Het
Igfbpl1 T C 4: 45,813,469 (GRCm39) T249A possibly damaging Het
Il33 A T 19: 29,930,139 (GRCm39) H78L probably benign Het
Inpp4b A T 8: 82,768,564 (GRCm39) D691V probably damaging Het
Itpr2 T A 6: 146,131,369 (GRCm39) N1945I probably damaging Het
Lnpep A G 17: 17,799,289 (GRCm39) V122A probably benign Het
Lrp2 T C 2: 69,305,747 (GRCm39) D2938G probably damaging Het
Lrrc8c A T 5: 105,756,403 (GRCm39) Y726F probably benign Het
Magi3 G T 3: 103,922,842 (GRCm39) Q1292K probably benign Het
Mllt3 A C 4: 87,692,324 (GRCm39) F546L probably damaging Het
Mrpl14 A G 17: 46,009,147 (GRCm39) K82R probably benign Het
Noxred1 A G 12: 87,271,653 (GRCm39) V172A possibly damaging Het
Obscn A T 11: 59,023,948 (GRCm39) I574N probably damaging Het
Or2n1b A G 17: 38,460,060 (GRCm39) T194A probably benign Het
Or5k8 T A 16: 58,644,671 (GRCm39) T134S probably benign Het
Osbpl11 T A 16: 33,054,864 (GRCm39) V649D probably benign Het
Pdlim2 G T 14: 70,403,579 (GRCm39) P278T probably benign Het
Pm20d2 A C 4: 33,183,152 (GRCm39) L223V probably damaging Het
Pmpcb G T 5: 21,948,388 (GRCm39) R223L probably damaging Het
Pole2 A T 12: 69,256,759 (GRCm39) Y255* probably null Het
Rims1 T A 1: 22,467,684 (GRCm39) I317L Het
Scnn1g C A 7: 121,341,554 (GRCm39) H239N probably benign Het
Spag17 A G 3: 100,010,426 (GRCm39) probably null Het
Tenm3 A T 8: 48,746,692 (GRCm39) F1038I probably damaging Het
Tshz2 T C 2: 169,727,971 (GRCm39) F856L probably damaging Het
Ubtf A G 11: 102,197,508 (GRCm39) S715P unknown Het
Usp13 A C 3: 32,959,579 (GRCm39) S557R probably damaging Het
Vmn2r7 A T 3: 64,623,397 (GRCm39) Y308N probably benign Het
Zfp455 A G 13: 67,346,685 (GRCm39) D32G probably damaging Het
Zfp512 T A 5: 31,634,225 (GRCm39) probably null Het
Zfr A G 15: 12,166,244 (GRCm39) E838G possibly damaging Het
Other mutations in Usp19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Usp19 APN 9 108,376,160 (GRCm39) missense possibly damaging 0.79
IGL02345:Usp19 APN 9 108,371,057 (GRCm39) missense probably benign
IGL03026:Usp19 APN 9 108,370,344 (GRCm39) missense probably damaging 1.00
IGL03057:Usp19 APN 9 108,376,329 (GRCm39) missense probably benign 0.01
IGL03073:Usp19 APN 9 108,373,002 (GRCm39) unclassified probably benign
IGL03333:Usp19 APN 9 108,371,348 (GRCm39) missense probably benign 0.05
PIT4576001:Usp19 UTSW 9 108,369,931 (GRCm39) critical splice donor site probably null
R0053:Usp19 UTSW 9 108,374,369 (GRCm39) splice site probably null
R0053:Usp19 UTSW 9 108,374,369 (GRCm39) splice site probably null
R0138:Usp19 UTSW 9 108,378,514 (GRCm39) missense possibly damaging 0.86
R0281:Usp19 UTSW 9 108,375,708 (GRCm39) missense probably damaging 1.00
R0386:Usp19 UTSW 9 108,376,910 (GRCm39) missense probably damaging 1.00
R0454:Usp19 UTSW 9 108,371,439 (GRCm39) critical splice donor site probably null
R0506:Usp19 UTSW 9 108,371,686 (GRCm39) missense probably damaging 1.00
R0542:Usp19 UTSW 9 108,371,584 (GRCm39) splice site probably null
R0800:Usp19 UTSW 9 108,372,353 (GRCm39) missense probably damaging 0.97
R0829:Usp19 UTSW 9 108,371,000 (GRCm39) missense probably benign
R1594:Usp19 UTSW 9 108,375,721 (GRCm39) missense probably damaging 1.00
R1917:Usp19 UTSW 9 108,376,524 (GRCm39) nonsense probably null
R3744:Usp19 UTSW 9 108,377,380 (GRCm39) missense probably damaging 1.00
R3964:Usp19 UTSW 9 108,375,228 (GRCm39) missense probably damaging 1.00
R4275:Usp19 UTSW 9 108,375,893 (GRCm39) missense probably damaging 1.00
R4789:Usp19 UTSW 9 108,370,433 (GRCm39) missense possibly damaging 0.75
R5247:Usp19 UTSW 9 108,373,264 (GRCm39) splice site probably null
R5249:Usp19 UTSW 9 108,369,807 (GRCm39) start codon destroyed probably null 0.85
R5400:Usp19 UTSW 9 108,377,392 (GRCm39) missense probably damaging 1.00
R5445:Usp19 UTSW 9 108,375,119 (GRCm39) missense possibly damaging 0.61
R5578:Usp19 UTSW 9 108,370,639 (GRCm39) missense probably benign
R5934:Usp19 UTSW 9 108,369,766 (GRCm39) unclassified probably benign
R6003:Usp19 UTSW 9 108,373,579 (GRCm39) missense probably damaging 1.00
R6217:Usp19 UTSW 9 108,377,343 (GRCm39) missense probably damaging 1.00
R6230:Usp19 UTSW 9 108,379,140 (GRCm39) missense probably damaging 0.99
R6505:Usp19 UTSW 9 108,374,082 (GRCm39) missense probably damaging 1.00
R6585:Usp19 UTSW 9 108,376,926 (GRCm39) missense probably damaging 0.97
R6865:Usp19 UTSW 9 108,376,018 (GRCm39) nonsense probably null
R6953:Usp19 UTSW 9 108,376,130 (GRCm39) missense possibly damaging 0.90
R7037:Usp19 UTSW 9 108,374,157 (GRCm39) missense possibly damaging 0.52
R7046:Usp19 UTSW 9 108,374,334 (GRCm39) missense possibly damaging 0.48
R7235:Usp19 UTSW 9 108,372,123 (GRCm39) nonsense probably null
R7699:Usp19 UTSW 9 108,373,371 (GRCm39) nonsense probably null
R7705:Usp19 UTSW 9 108,379,112 (GRCm39) missense possibly damaging 0.89
R8175:Usp19 UTSW 9 108,377,377 (GRCm39) missense probably damaging 1.00
R8551:Usp19 UTSW 9 108,376,496 (GRCm39) missense possibly damaging 0.50
R8725:Usp19 UTSW 9 108,370,934 (GRCm39) missense probably damaging 1.00
R9142:Usp19 UTSW 9 108,372,284 (GRCm39) missense possibly damaging 0.79
R9143:Usp19 UTSW 9 108,375,398 (GRCm39) missense probably damaging 1.00
R9421:Usp19 UTSW 9 108,376,792 (GRCm39) missense probably damaging 1.00
R9508:Usp19 UTSW 9 108,371,608 (GRCm39) missense probably damaging 1.00
R9663:Usp19 UTSW 9 108,371,894 (GRCm39) missense probably damaging 1.00
R9731:Usp19 UTSW 9 108,376,885 (GRCm39) missense probably damaging 1.00
RF041:Usp19 UTSW 9 108,371,187 (GRCm39) critical splice acceptor site unknown
Predicted Primers PCR Primer
(F):5'- GGCTTCCCTTATCACTGGAC -3'
(R):5'- TCTGCCTCCAATCGAGCAAC -3'

Sequencing Primer
(F):5'- TCACTGGACATGCAAGTATTGG -3'
(R):5'- TCGAGCAACAATTCTACAGGG -3'
Posted On 2019-06-07