Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4504001:Usp19'

556014

Institutional Source

Beutler Lab

Gene Symbol

Usp19

Ensembl Gene

ENSMUSG00000006676

Gene Name

ubiquitin specific peptidase 19

Synonyms

8430421I07Rik

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.299) question?

Stock #

PIT4504001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

108490602-108502337 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 108492970 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 43 (S43T)

Ref Sequence

ENSEMBL: ENSMUSP00000006854 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006854] [ENSMUST00000065014] [ENSMUST00000085044] [ENSMUST00000166103] [ENSMUST00000178075] [ENSMUST00000193678]

AlphaFold

Q3UJD6

Predicted Effect

probably benign
Transcript: ENSMUST00000006854
AA Change: S43T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000006854
Gene: ENSMUSG00000006676
AA Change: S43T

Domain	Start	End	E-Value	Type
Pfam:CS	55	129	1.3e-6	PFAM
low complexity region	257	268	N/A	INTRINSIC
Pfam:CS	326	414	7.1e-19	PFAM
Pfam:USP19_linker	415	537	2.2e-61	PFAM
Pfam:UCH	538	1253	1.2e-77	PFAM
Pfam:UCH_1	539	874	8.6e-11	PFAM
Pfam:zf-MYND	833	875	9.9e-11	PFAM
Pfam:UCH_1	1021	1235	7.1e-10	PFAM
low complexity region	1278	1287	N/A	INTRINSIC
low complexity region	1301	1312	N/A	INTRINSIC
transmembrane domain	1333	1355	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000065014

SMART Domains

Protein: ENSMUSP00000069087
Gene: ENSMUSG00000052911

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
LamNT	44	284	1.9e-102	SMART
EGF_Lam	286	347	1.34e-6	SMART
EGF_Lam	350	410	6.1e-10	SMART
EGF_Lam	413	470	2.98e-13	SMART
EGF_Lam	473	522	7.93e-9	SMART
EGF_Lam	525	569	1.01e-10	SMART
EGF_Lam	784	829	3.42e-13	SMART
EGF_Lam	832	875	6.54e-10	SMART
EGF_Lam	878	925	1.34e-6	SMART
EGF_Lam	928	984	4.74e-7	SMART
EGF_Lam	987	1036	1.53e-10	SMART
EGF_Lam	1039	1093	6.29e-12	SMART
EGF_Lam	1096	1141	1.79e-7	SMART
EGF_Lam	1144	1188	6.64e-11	SMART
coiled coil region	1261	1299	N/A	INTRINSIC
low complexity region	1445	1458	N/A	INTRINSIC
coiled coil region	1473	1527	N/A	INTRINSIC
low complexity region	1609	1625	N/A	INTRINSIC
SCOP:d1eq1a_	1632	1786	5e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000085044
AA Change: S43T

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000082119
Gene: ENSMUSG00000006676
AA Change: S43T

Domain	Start	End	E-Value	Type
Pfam:CS	55	129	4.7e-7	PFAM
low complexity region	257	268	N/A	INTRINSIC
Pfam:CS	326	414	2.5e-15	PFAM
low complexity region	449	460	N/A	INTRINSIC
low complexity region	524	530	N/A	INTRINSIC
Pfam:UCH	538	1253	7.4e-84	PFAM
Pfam:UCH_1	539	879	2.3e-13	PFAM
Pfam:zf-MYND	833	875	2.4e-10	PFAM
Pfam:UCH_1	1020	1235	2.9e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000166103
AA Change: S43T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000128573
Gene: ENSMUSG00000006676
AA Change: S43T

Domain	Start	End	E-Value	Type
Pfam:CS	55	129	2.6e-7	PFAM
low complexity region	257	268	N/A	INTRINSIC
Pfam:CS	326	390	3.9e-9	PFAM
low complexity region	425	436	N/A	INTRINSIC
low complexity region	500	506	N/A	INTRINSIC
Pfam:UCH	514	1229	1.8e-84	PFAM
Pfam:UCH_1	515	855	5.5e-14	PFAM
Pfam:zf-MYND	809	851	1.7e-10	PFAM
Pfam:UCH_1	996	1211	6.9e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000178075
AA Change: S43T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000135930
Gene: ENSMUSG00000006676
AA Change: S43T

Domain	Start	End	E-Value	Type
Pfam:CS	55	129	1e-6	PFAM
low complexity region	258	269	N/A	INTRINSIC
Pfam:CS	327	415	5.4e-15	PFAM
low complexity region	450	461	N/A	INTRINSIC
low complexity region	525	531	N/A	INTRINSIC
Pfam:UCH	539	1254	4.9e-84	PFAM
Pfam:UCH_1	540	880	1.4e-13	PFAM
Pfam:zf-MYND	834	876	5.2e-10	PFAM
Pfam:UCH_1	1021	1236	1.8e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000193558

Predicted Effect

probably benign
Transcript: ENSMUST00000193678
AA Change: S43T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000141738
Gene: ENSMUSG00000006676
AA Change: S43T

Domain	Start	End	E-Value	Type
Pfam:CS	55	129	6.8e-7	PFAM
low complexity region	258	269	N/A	INTRINSIC
Pfam:CS	327	415	3.6e-15	PFAM
low complexity region	448	459	N/A	INTRINSIC
low complexity region	523	529	N/A	INTRINSIC
Pfam:UCH	537	1252	3.8e-84	PFAM
Pfam:UCH_1	538	878	1.1e-13	PFAM
Pfam:zf-MYND	832	874	5.1e-10	PFAM
Pfam:UCH_1	1019	1234	1.4e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000194171

Predicted Effect

probably benign
Transcript: ENSMUST00000194863

Coding Region Coverage

1x: 92.8%
3x: 90.6%
10x: 84.7%
20x: 71.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit decreased body weight, reduced male fertility, and increased resistance to skeletal muscle atrophy induced by both glucocorticoids and denervation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abtb2	T	A	2: 103,717,192	C970*	probably null	Het
Adgrv1	G	A	13: 81,559,352	P1312S	probably damaging	Het
Als2cr12	T	A	1: 58,659,099	I348F	probably benign	Het
Arid5a	T	C	1: 36,317,625	I116T	probably damaging	Het
Bank1	C	A	3: 136,100,419	D485Y	probably damaging	Het
Cbln3	C	T	14: 55,883,499	V122M	probably damaging	Het
Cox10	C	T	11: 63,964,216	C413Y	possibly damaging	Het
Ctsll3	T	A	13: 60,801,009	D44V	probably benign	Het
Cuzd1	A	T	7: 131,309,800	N483K	possibly damaging	Het
Dcaf4	G	A	12: 83,534,011		probably null	Het
Ddx60	A	G	8: 61,958,113	T470A	probably benign	Het
Dennd1b	T	C	1: 139,040,004	V44A	probably benign	Het
Dusp16	C	A	6: 134,739,883	V154F	possibly damaging	Het
Ect2	G	A	3: 27,126,948	R586*	probably null	Het
Ermard	T	A	17: 15,058,822	C460*	probably null	Het
Fat2	C	T	11: 55,256,110	G4020D	possibly damaging	Het
Galnt16	G	T	12: 80,592,417	E402*	probably null	Het
Gm5414	T	G	15: 101,625,823	D282A	probably damaging	Het
Gm6741	C	T	17: 91,236,916	Q36*	probably null	Het
Gm7356	A	T	17: 14,001,458	L103Q	probably damaging	Het
Hcn1	A	G	13: 117,975,875	T792A	possibly damaging	Het
Hemgn	T	C	4: 46,395,863	N458D	probably benign	Het
Hesx1	C	A	14: 27,001,881	D140E	probably benign	Het
Hfe2	A	T	3: 96,528,497	D357V	probably damaging	Het
Hmgcr	A	G	13: 96,663,097	I163T	possibly damaging	Het
Igfbpl1	T	C	4: 45,813,469	T249A	possibly damaging	Het
Il33	A	T	19: 29,952,739	H78L	probably benign	Het
Inpp4b	A	T	8: 82,041,935	D691V	probably damaging	Het
Itpr2	T	A	6: 146,229,871	N1945I	probably damaging	Het
Lnpep	A	G	17: 17,579,027	V122A	probably benign	Het
Lrp2	T	C	2: 69,475,403	D2938G	probably damaging	Het
Lrrc8c	A	T	5: 105,608,537	Y726F	probably benign	Het
Magi3	G	T	3: 104,015,526	Q1292K	probably benign	Het
Mllt3	A	C	4: 87,774,087	F546L	probably damaging	Het
Mrpl14	A	G	17: 45,698,221	K82R	probably benign	Het
Noxred1	A	G	12: 87,224,879	V172A	possibly damaging	Het
Obscn	A	T	11: 59,133,122	I574N	probably damaging	Het
Olfr133	A	G	17: 38,149,169	T194A	probably benign	Het
Olfr175-ps1	T	A	16: 58,824,308	T134S	probably benign	Het
Osbpl11	T	A	16: 33,234,494	V649D	probably benign	Het
Pdlim2	G	T	14: 70,166,130	P278T	probably benign	Het
Pm20d2	A	C	4: 33,183,152	L223V	probably damaging	Het
Pmpcb	G	T	5: 21,743,390	R223L	probably damaging	Het
Pole2	A	T	12: 69,209,985	Y255*	probably null	Het
Rims1	T	A	1: 22,397,460	I317L		Het
Scnn1g	C	A	7: 121,742,331	H239N	probably benign	Het
Spag17	A	G	3: 100,103,110		probably null	Het
Tenm3	A	T	8: 48,293,657	F1038I	probably damaging	Het
Tshz2	T	C	2: 169,886,051	F856L	probably damaging	Het
Ubtf	A	G	11: 102,306,682	S715P	unknown	Het
Usp13	A	C	3: 32,905,430	S557R	probably damaging	Het
Vmn2r7	A	T	3: 64,715,976	Y308N	probably benign	Het
Zfp455	A	G	13: 67,198,621	D32G	probably damaging	Het
Zfp512	T	A	5: 31,476,881		probably null	Het
Zfr	A	G	15: 12,166,158	E838G	possibly damaging	Het

Other mutations in Usp19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01327:Usp19	APN	9	108498961	missense	possibly damaging	0.79
IGL02345:Usp19	APN	9	108493858	missense	probably benign
IGL03026:Usp19	APN	9	108493145	missense	probably damaging	1.00
IGL03057:Usp19	APN	9	108499130	missense	probably benign	0.01
IGL03073:Usp19	APN	9	108495803	unclassified	probably benign
IGL03333:Usp19	APN	9	108494149	missense	probably benign	0.05
PIT4576001:Usp19	UTSW	9	108492732	critical splice donor site	probably null
R0053:Usp19	UTSW	9	108497170	splice site	probably null
R0053:Usp19	UTSW	9	108497170	splice site	probably null
R0138:Usp19	UTSW	9	108501315	missense	possibly damaging	0.86
R0281:Usp19	UTSW	9	108498509	missense	probably damaging	1.00
R0386:Usp19	UTSW	9	108499711	missense	probably damaging	1.00
R0454:Usp19	UTSW	9	108494240	critical splice donor site	probably null
R0506:Usp19	UTSW	9	108494487	missense	probably damaging	1.00
R0542:Usp19	UTSW	9	108494385	splice site	probably null
R0800:Usp19	UTSW	9	108495154	missense	probably damaging	0.97
R0829:Usp19	UTSW	9	108493801	missense	probably benign
R1594:Usp19	UTSW	9	108498522	missense	probably damaging	1.00
R1917:Usp19	UTSW	9	108499325	nonsense	probably null
R3744:Usp19	UTSW	9	108500181	missense	probably damaging	1.00
R3964:Usp19	UTSW	9	108498029	missense	probably damaging	1.00
R4275:Usp19	UTSW	9	108498694	missense	probably damaging	1.00
R4789:Usp19	UTSW	9	108493234	missense	possibly damaging	0.75
R5247:Usp19	UTSW	9	108496065	splice site	probably null
R5249:Usp19	UTSW	9	108492608	start codon destroyed	probably null	0.85
R5400:Usp19	UTSW	9	108500193	missense	probably damaging	1.00
R5445:Usp19	UTSW	9	108497920	missense	possibly damaging	0.61
R5578:Usp19	UTSW	9	108493440	missense	probably benign
R5934:Usp19	UTSW	9	108492567	unclassified	probably benign
R6003:Usp19	UTSW	9	108496380	missense	probably damaging	1.00
R6217:Usp19	UTSW	9	108500144	missense	probably damaging	1.00
R6230:Usp19	UTSW	9	108501941	missense	probably damaging	0.99
R6505:Usp19	UTSW	9	108496883	missense	probably damaging	1.00
R6585:Usp19	UTSW	9	108499727	missense	probably damaging	0.97
R6865:Usp19	UTSW	9	108498819	nonsense	probably null
R6953:Usp19	UTSW	9	108498931	missense	possibly damaging	0.90
R7037:Usp19	UTSW	9	108496958	missense	possibly damaging	0.52
R7046:Usp19	UTSW	9	108497135	missense	possibly damaging	0.48
R7235:Usp19	UTSW	9	108494924	nonsense	probably null
R7699:Usp19	UTSW	9	108496172	nonsense	probably null
R7705:Usp19	UTSW	9	108501913	missense	possibly damaging	0.89
R8175:Usp19	UTSW	9	108500178	missense	probably damaging	1.00
R8551:Usp19	UTSW	9	108499297	missense	possibly damaging	0.50
R8725:Usp19	UTSW	9	108493735	missense	probably damaging	1.00
R9142:Usp19	UTSW	9	108495085	missense	possibly damaging	0.79
R9143:Usp19	UTSW	9	108498199	missense	probably damaging	1.00
R9421:Usp19	UTSW	9	108499593	missense	probably damaging	1.00
R9508:Usp19	UTSW	9	108494409	missense	probably damaging	1.00
R9663:Usp19	UTSW	9	108494695	missense	probably damaging	1.00
R9731:Usp19	UTSW	9	108499686	missense	probably damaging	1.00
RF041:Usp19	UTSW	9	108493988	critical splice acceptor site	unknown

Predicted Primers

PCR Primer
(F):5'- GGCTTCCCTTATCACTGGAC -3'
(R):5'- TCTGCCTCCAATCGAGCAAC -3'

Sequencing Primer
(F):5'- TCACTGGACATGCAAGTATTGG -3'
(R):5'- TCGAGCAACAATTCTACAGGG -3'

Posted On

2019-06-07