Incidental Mutation 'PIT4504001:Cox10'
ID 556017
Institutional Source Beutler Lab
Gene Symbol Cox10
Ensembl Gene ENSMUSG00000042148
Gene Name cytochrome c oxidase assembly protein 10
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock # PIT4504001 (G1)
Quality Score 218.009
Status Not validated
Chromosome 11
Chromosomal Location 63962627-64079468 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 63964216 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 413 (C413Y)
Ref Sequence ENSEMBL: ENSMUSP00000040138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049091]
AlphaFold Q8CFY5
Predicted Effect possibly damaging
Transcript: ENSMUST00000049091
AA Change: C413Y

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000040138
Gene: ENSMUSG00000042148
AA Change: C413Y

DomainStartEndE-ValueType
Pfam:UbiA 168 418 5e-58 PFAM
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.6%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes heme A:farnesyltransferase, which is not a structural subunit but required for the expression of functional COX and functions in the maturation of the heme A prosthetic group of COX. This protein is predicted to contain 7-9 transmembrane domains localized in the mitochondrial inner membrane. A gene mutation, which results in the substitution of a lysine for an asparagine (N204K), is identified to be responsible for cytochrome c oxidase deficiency. In addition, this gene is disrupted in patients with CMT1A (Charcot-Marie-Tooth type 1A) duplication and with HNPP (hereditary neuropathy with liability to pressure palsies) deletion. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T A 2: 103,717,192 C970* probably null Het
Adgrv1 G A 13: 81,559,352 P1312S probably damaging Het
Als2cr12 T A 1: 58,659,099 I348F probably benign Het
Arid5a T C 1: 36,317,625 I116T probably damaging Het
Bank1 C A 3: 136,100,419 D485Y probably damaging Het
Cbln3 C T 14: 55,883,499 V122M probably damaging Het
Ctsll3 T A 13: 60,801,009 D44V probably benign Het
Cuzd1 A T 7: 131,309,800 N483K possibly damaging Het
Dcaf4 G A 12: 83,534,011 probably null Het
Ddx60 A G 8: 61,958,113 T470A probably benign Het
Dennd1b T C 1: 139,040,004 V44A probably benign Het
Dusp16 C A 6: 134,739,883 V154F possibly damaging Het
Ect2 G A 3: 27,126,948 R586* probably null Het
Ermard T A 17: 15,058,822 C460* probably null Het
Fat2 C T 11: 55,256,110 G4020D possibly damaging Het
Galnt16 G T 12: 80,592,417 E402* probably null Het
Gm5414 T G 15: 101,625,823 D282A probably damaging Het
Gm6741 C T 17: 91,236,916 Q36* probably null Het
Gm7356 A T 17: 14,001,458 L103Q probably damaging Het
Hcn1 A G 13: 117,975,875 T792A possibly damaging Het
Hemgn T C 4: 46,395,863 N458D probably benign Het
Hesx1 C A 14: 27,001,881 D140E probably benign Het
Hfe2 A T 3: 96,528,497 D357V probably damaging Het
Hmgcr A G 13: 96,663,097 I163T possibly damaging Het
Igfbpl1 T C 4: 45,813,469 T249A possibly damaging Het
Il33 A T 19: 29,952,739 H78L probably benign Het
Inpp4b A T 8: 82,041,935 D691V probably damaging Het
Itpr2 T A 6: 146,229,871 N1945I probably damaging Het
Lnpep A G 17: 17,579,027 V122A probably benign Het
Lrp2 T C 2: 69,475,403 D2938G probably damaging Het
Lrrc8c A T 5: 105,608,537 Y726F probably benign Het
Magi3 G T 3: 104,015,526 Q1292K probably benign Het
Mllt3 A C 4: 87,774,087 F546L probably damaging Het
Mrpl14 A G 17: 45,698,221 K82R probably benign Het
Noxred1 A G 12: 87,224,879 V172A possibly damaging Het
Obscn A T 11: 59,133,122 I574N probably damaging Het
Olfr133 A G 17: 38,149,169 T194A probably benign Het
Olfr175-ps1 T A 16: 58,824,308 T134S probably benign Het
Osbpl11 T A 16: 33,234,494 V649D probably benign Het
Pdlim2 G T 14: 70,166,130 P278T probably benign Het
Pm20d2 A C 4: 33,183,152 L223V probably damaging Het
Pmpcb G T 5: 21,743,390 R223L probably damaging Het
Pole2 A T 12: 69,209,985 Y255* probably null Het
Rims1 T A 1: 22,397,460 I317L Het
Scnn1g C A 7: 121,742,331 H239N probably benign Het
Spag17 A G 3: 100,103,110 probably null Het
Tenm3 A T 8: 48,293,657 F1038I probably damaging Het
Tshz2 T C 2: 169,886,051 F856L probably damaging Het
Ubtf A G 11: 102,306,682 S715P unknown Het
Usp13 A C 3: 32,905,430 S557R probably damaging Het
Usp19 T A 9: 108,492,970 S43T probably benign Het
Vmn2r7 A T 3: 64,715,976 Y308N probably benign Het
Zfp455 A G 13: 67,198,621 D32G probably damaging Het
Zfp512 T A 5: 31,476,881 probably null Het
Zfr A G 15: 12,166,158 E838G possibly damaging Het
Other mutations in Cox10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02746:Cox10 APN 11 63964531 splice site probably benign
R0548:Cox10 UTSW 11 63976352 missense probably damaging 1.00
R0811:Cox10 UTSW 11 64071713 missense probably benign
R0812:Cox10 UTSW 11 64071713 missense probably benign
R2175:Cox10 UTSW 11 64071649 missense probably benign 0.01
R4290:Cox10 UTSW 11 63964255 missense probably benign 0.00
R4681:Cox10 UTSW 11 63976451 missense possibly damaging 0.94
R4770:Cox10 UTSW 11 63964163 missense probably benign 0.00
R5873:Cox10 UTSW 11 64071686 missense probably benign 0.00
R6457:Cox10 UTSW 11 63964372 missense probably damaging 0.99
R7955:Cox10 UTSW 11 63993924 missense probably benign 0.25
R8731:Cox10 UTSW 11 63964219 missense probably damaging 1.00
R8821:Cox10 UTSW 11 63964480 missense probably damaging 1.00
R8831:Cox10 UTSW 11 63964480 missense probably damaging 1.00
R8883:Cox10 UTSW 11 63993949 missense probably damaging 1.00
R9684:Cox10 UTSW 11 63964381 missense probably damaging 1.00
X0064:Cox10 UTSW 11 63993957 critical splice acceptor site probably null
Z1177:Cox10 UTSW 11 63976470 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AAAATACGCTTCCTGCTGGC -3'
(R):5'- CTGTATGATGTCCGTCACCC -3'

Sequencing Primer
(F):5'- CCCAGGGCAGTGCTGTC -3'
(R):5'- GTATGATGTCCGTCACCCATCCAG -3'
Posted On 2019-06-07