Incidental Mutation 'PIT4504001:Ubtf'
ID 556018
Institutional Source Beutler Lab
Gene Symbol Ubtf
Ensembl Gene ENSMUSG00000020923
Gene Name upstream binding transcription factor, RNA polymerase I
Synonyms UBF1, UBF, A930005G04Rik, Tcfubf
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # PIT4504001 (G1)
Quality Score 181.009
Status Not validated
Chromosome 11
Chromosomal Location 102195386-102210568 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 102197508 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 715 (S715P)
Ref Sequence ENSEMBL: ENSMUSP00000136310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006754] [ENSMUST00000079589] [ENSMUST00000107115] [ENSMUST00000107117] [ENSMUST00000107119] [ENSMUST00000107123] [ENSMUST00000173870] [ENSMUST00000174302] [ENSMUST00000178839]
AlphaFold no structure available at present
Predicted Effect silent
Transcript: ENSMUST00000006754
SMART Domains Protein: ENSMUSP00000006754
Gene: ENSMUSG00000020923

DomainStartEndE-ValueType
Blast:SANT 18 78 6e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 260 326 1.1e-14 SMART
HMG 369 439 6.29e-19 SMART
HMG 444 513 4.74e-5 SMART
HMG 530 598 2.54e-14 SMART
low complexity region 640 661 N/A INTRINSIC
low complexity region 677 705 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000079589
AA Change: S752P
SMART Domains Protein: ENSMUSP00000078539
Gene: ENSMUSG00000020923
AA Change: S752P

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 195 265 1.95e-15 SMART
HMG 297 363 1.1e-14 SMART
HMG 406 476 6.29e-19 SMART
HMG 481 550 4.74e-5 SMART
HMG 567 635 2.54e-14 SMART
low complexity region 675 763 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000107115
AA Change: S715P
SMART Domains Protein: ENSMUSP00000102732
Gene: ENSMUSG00000020923
AA Change: S715P

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 260 326 1.1e-14 SMART
HMG 369 439 6.29e-19 SMART
HMG 444 513 4.74e-5 SMART
HMG 530 598 2.54e-14 SMART
low complexity region 638 726 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000107117
AA Change: S715P
SMART Domains Protein: ENSMUSP00000102734
Gene: ENSMUSG00000020923
AA Change: S715P

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 260 326 1.1e-14 SMART
HMG 369 439 6.29e-19 SMART
HMG 444 513 4.74e-5 SMART
HMG 530 598 2.54e-14 SMART
low complexity region 638 726 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000107119
AA Change: S715P
SMART Domains Protein: ENSMUSP00000102736
Gene: ENSMUSG00000020923
AA Change: S715P

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 260 326 1.1e-14 SMART
HMG 369 439 6.29e-19 SMART
HMG 444 513 4.74e-5 SMART
HMG 530 598 2.54e-14 SMART
low complexity region 638 726 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000107123
AA Change: S752P
SMART Domains Protein: ENSMUSP00000102740
Gene: ENSMUSG00000020923
AA Change: S752P

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 195 265 1.95e-15 SMART
HMG 297 363 1.1e-14 SMART
HMG 406 476 6.29e-19 SMART
HMG 481 550 4.74e-5 SMART
HMG 567 635 2.54e-14 SMART
low complexity region 675 763 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000173870
AA Change: S752P
SMART Domains Protein: ENSMUSP00000133611
Gene: ENSMUSG00000020923
AA Change: S752P

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 195 265 1.95e-15 SMART
HMG 297 363 1.1e-14 SMART
HMG 406 476 6.29e-19 SMART
HMG 481 550 4.74e-5 SMART
HMG 567 635 2.54e-14 SMART
low complexity region 675 763 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000174302
AA Change: S752P
SMART Domains Protein: ENSMUSP00000133844
Gene: ENSMUSG00000020923
AA Change: S752P

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 195 265 1.95e-15 SMART
HMG 297 363 1.1e-14 SMART
HMG 406 476 6.29e-19 SMART
HMG 481 550 4.74e-5 SMART
HMG 567 635 2.54e-14 SMART
low complexity region 675 763 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000178839
AA Change: S715P
SMART Domains Protein: ENSMUSP00000136310
Gene: ENSMUSG00000020923
AA Change: S715P

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 260 326 1.1e-14 SMART
HMG 369 439 6.29e-19 SMART
HMG 444 513 4.74e-5 SMART
HMG 530 598 2.54e-14 SMART
low complexity region 638 726 N/A INTRINSIC
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.6%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the HMG-box DNA-binding protein family. The encoded protein plays a critical role in ribosomal RNA transcription as a key component of the pre-initiation complex, mediating the recruitment of RNA polymerase I to rDNA promoter regions. The encoded protein may also play important roles in chromatin remodeling and pre-rRNA processing, and its activity is regulated by both phosphorylation and acetylation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. Pseudogenes of this gene are located on the short arm of chromosomes 3, 11 and X and the long arm of chromosome 11. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality before implantation with embryonic growth arrest. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T A 2: 103,547,537 (GRCm39) C970* probably null Het
Adgrv1 G A 13: 81,707,471 (GRCm39) P1312S probably damaging Het
Arid5a T C 1: 36,356,706 (GRCm39) I116T probably damaging Het
Bank1 C A 3: 135,806,180 (GRCm39) D485Y probably damaging Het
Cbln3 C T 14: 56,120,956 (GRCm39) V122M probably damaging Het
Cox10 C T 11: 63,855,042 (GRCm39) C413Y possibly damaging Het
Ctsll3 T A 13: 60,948,823 (GRCm39) D44V probably benign Het
Cuzd1 A T 7: 130,911,529 (GRCm39) N483K possibly damaging Het
Dcaf4 G A 12: 83,580,785 (GRCm39) probably null Het
Ddx60 A G 8: 62,411,147 (GRCm39) T470A probably benign Het
Dennd1b T C 1: 138,967,742 (GRCm39) V44A probably benign Het
Dusp16 C A 6: 134,716,846 (GRCm39) V154F possibly damaging Het
Ect2 G A 3: 27,181,097 (GRCm39) R586* probably null Het
Ermard T A 17: 15,279,084 (GRCm39) C460* probably null Het
Fat2 C T 11: 55,146,936 (GRCm39) G4020D possibly damaging Het
Flacc1 T A 1: 58,698,258 (GRCm39) I348F probably benign Het
Galnt16 G T 12: 80,639,191 (GRCm39) E402* probably null Het
Gm5414 T G 15: 101,534,258 (GRCm39) D282A probably damaging Het
Gm6741 C T 17: 91,544,344 (GRCm39) Q36* probably null Het
Gm7356 A T 17: 14,221,720 (GRCm39) L103Q probably damaging Het
Hcn1 A G 13: 118,112,411 (GRCm39) T792A possibly damaging Het
Hemgn T C 4: 46,395,863 (GRCm39) N458D probably benign Het
Hesx1 C A 14: 26,723,838 (GRCm39) D140E probably benign Het
Hjv A T 3: 96,435,813 (GRCm39) D357V probably damaging Het
Hmgcr A G 13: 96,799,605 (GRCm39) I163T possibly damaging Het
Igfbpl1 T C 4: 45,813,469 (GRCm39) T249A possibly damaging Het
Il33 A T 19: 29,930,139 (GRCm39) H78L probably benign Het
Inpp4b A T 8: 82,768,564 (GRCm39) D691V probably damaging Het
Itpr2 T A 6: 146,131,369 (GRCm39) N1945I probably damaging Het
Lnpep A G 17: 17,799,289 (GRCm39) V122A probably benign Het
Lrp2 T C 2: 69,305,747 (GRCm39) D2938G probably damaging Het
Lrrc8c A T 5: 105,756,403 (GRCm39) Y726F probably benign Het
Magi3 G T 3: 103,922,842 (GRCm39) Q1292K probably benign Het
Mllt3 A C 4: 87,692,324 (GRCm39) F546L probably damaging Het
Mrpl14 A G 17: 46,009,147 (GRCm39) K82R probably benign Het
Noxred1 A G 12: 87,271,653 (GRCm39) V172A possibly damaging Het
Obscn A T 11: 59,023,948 (GRCm39) I574N probably damaging Het
Or2n1b A G 17: 38,460,060 (GRCm39) T194A probably benign Het
Or5k8 T A 16: 58,644,671 (GRCm39) T134S probably benign Het
Osbpl11 T A 16: 33,054,864 (GRCm39) V649D probably benign Het
Pdlim2 G T 14: 70,403,579 (GRCm39) P278T probably benign Het
Pm20d2 A C 4: 33,183,152 (GRCm39) L223V probably damaging Het
Pmpcb G T 5: 21,948,388 (GRCm39) R223L probably damaging Het
Pole2 A T 12: 69,256,759 (GRCm39) Y255* probably null Het
Rims1 T A 1: 22,467,684 (GRCm39) I317L Het
Scnn1g C A 7: 121,341,554 (GRCm39) H239N probably benign Het
Spag17 A G 3: 100,010,426 (GRCm39) probably null Het
Tenm3 A T 8: 48,746,692 (GRCm39) F1038I probably damaging Het
Tshz2 T C 2: 169,727,971 (GRCm39) F856L probably damaging Het
Usp13 A C 3: 32,959,579 (GRCm39) S557R probably damaging Het
Usp19 T A 9: 108,370,169 (GRCm39) S43T probably benign Het
Vmn2r7 A T 3: 64,623,397 (GRCm39) Y308N probably benign Het
Zfp455 A G 13: 67,346,685 (GRCm39) D32G probably damaging Het
Zfp512 T A 5: 31,634,225 (GRCm39) probably null Het
Zfr A G 15: 12,166,244 (GRCm39) E838G possibly damaging Het
Other mutations in Ubtf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Ubtf APN 11 102,199,710 (GRCm39) splice site probably benign
IGL02168:Ubtf APN 11 102,204,994 (GRCm39) missense probably damaging 0.99
IGL02218:Ubtf APN 11 102,197,526 (GRCm39) nonsense probably null
FR4304:Ubtf UTSW 11 102,197,784 (GRCm39) small insertion probably benign
FR4304:Ubtf UTSW 11 102,197,782 (GRCm39) small insertion probably benign
FR4340:Ubtf UTSW 11 102,197,776 (GRCm39) small insertion probably benign
FR4342:Ubtf UTSW 11 102,197,785 (GRCm39) small insertion probably benign
FR4342:Ubtf UTSW 11 102,197,782 (GRCm39) small insertion probably benign
FR4449:Ubtf UTSW 11 102,197,774 (GRCm39) nonsense probably null
FR4548:Ubtf UTSW 11 102,197,784 (GRCm39) small insertion probably benign
FR4589:Ubtf UTSW 11 102,197,771 (GRCm39) small insertion probably benign
FR4589:Ubtf UTSW 11 102,197,769 (GRCm39) small insertion probably benign
FR4737:Ubtf UTSW 11 102,197,776 (GRCm39) small insertion probably benign
FR4737:Ubtf UTSW 11 102,197,774 (GRCm39) nonsense probably null
FR4976:Ubtf UTSW 11 102,197,785 (GRCm39) small insertion probably benign
R0919:Ubtf UTSW 11 102,200,603 (GRCm39) splice site probably benign
R1023:Ubtf UTSW 11 102,202,276 (GRCm39) missense possibly damaging 0.93
R1641:Ubtf UTSW 11 102,201,757 (GRCm39) missense probably damaging 1.00
R1678:Ubtf UTSW 11 102,199,804 (GRCm39) missense probably benign 0.01
R1780:Ubtf UTSW 11 102,205,744 (GRCm39) missense probably damaging 1.00
R2406:Ubtf UTSW 11 102,199,528 (GRCm39) nonsense probably null
R4574:Ubtf UTSW 11 102,197,591 (GRCm39) unclassified probably benign
R4986:Ubtf UTSW 11 102,205,000 (GRCm39) missense probably benign 0.03
R5057:Ubtf UTSW 11 102,197,913 (GRCm39) missense probably damaging 0.96
R5217:Ubtf UTSW 11 102,199,128 (GRCm39) missense probably null 0.91
R5221:Ubtf UTSW 11 102,198,816 (GRCm39) nonsense probably null
R5532:Ubtf UTSW 11 102,199,785 (GRCm39) missense probably benign 0.00
R5634:Ubtf UTSW 11 102,201,150 (GRCm39) missense probably damaging 1.00
R6185:Ubtf UTSW 11 102,204,849 (GRCm39) missense probably damaging 1.00
R7028:Ubtf UTSW 11 102,205,806 (GRCm39) missense probably benign 0.03
R7450:Ubtf UTSW 11 102,197,475 (GRCm39) missense unknown
R7596:Ubtf UTSW 11 102,197,533 (GRCm39) missense unknown
R7601:Ubtf UTSW 11 102,197,480 (GRCm39) missense unknown
R8376:Ubtf UTSW 11 102,199,737 (GRCm39) missense probably damaging 1.00
R8934:Ubtf UTSW 11 102,204,855 (GRCm39) missense probably damaging 0.98
R8947:Ubtf UTSW 11 102,205,802 (GRCm39) missense possibly damaging 0.67
R9102:Ubtf UTSW 11 102,201,015 (GRCm39) critical splice donor site probably null
R9395:Ubtf UTSW 11 102,205,026 (GRCm39) missense probably damaging 1.00
R9701:Ubtf UTSW 11 102,199,718 (GRCm39) critical splice donor site probably null
RF027:Ubtf UTSW 11 102,197,771 (GRCm39) small insertion probably benign
RF036:Ubtf UTSW 11 102,197,771 (GRCm39) small insertion probably benign
RF041:Ubtf UTSW 11 102,197,771 (GRCm39) small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AGTCTGATGGTTGCTGTCCC -3'
(R):5'- TCTGAGTCCAGCAGTGAAGATG -3'

Sequencing Primer
(F):5'- AAGGCTGCAGAGTCCTAGCTTG -3'
(R):5'- TCCAGCAGTGAAGATGAAAGC -3'
Posted On 2019-06-07