Incidental Mutation 'R0604:Mtrf1'
ID55602
Institutional Source Beutler Lab
Gene Symbol Mtrf1
Ensembl Gene ENSMUSG00000022022
Gene Namemitochondrial translational release factor 1
Synonyms
MMRRC Submission 038793-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R0604 (G1)
Quality Score189
Status Not validated
Chromosome14
Chromosomal Location79397772-79423587 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79415887 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 334 (V334A)
Ref Sequence ENSEMBL: ENSMUSP00000022600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022600]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022600
AA Change: V334A

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022600
Gene: ENSMUSG00000022022
AA Change: V334A

DomainStartEndE-ValueType
low complexity region 104 119 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
PCRF 139 255 5.96e-27 SMART
Pfam:RF-1 290 400 2.6e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227610
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was determined by in silico methods to be a mitochondrial protein with similarity to the peptide chain release factors (RFs) discovered in bacteria and yeast. The peptide chain release factors direct the termination of translation in response to the peptide chain termination codons. Initially thought to have a role in the termination of mitochondria protein synthesis, a recent publication found no mitochondrial translation release functionality. Multiple alternatively spliced transcript variants have been suggested by mRNA and EST data; however, their full-length natures are not clear. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik C A 2: 28,466,091 R60L possibly damaging Het
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Acap1 T C 11: 69,884,625 E302G probably benign Het
Adrb2 G A 18: 62,178,515 T413I possibly damaging Het
Aqr T C 2: 114,130,604 K725R probably benign Het
Braf A G 6: 39,623,697 I662T probably damaging Het
Ccdc178 A G 18: 22,067,443 S435P probably benign Het
Chd9 A G 8: 91,036,542 M2332V possibly damaging Het
Clgn T C 8: 83,424,194 V496A probably benign Het
Dnah17 A C 11: 118,121,471 S193R probably benign Het
Dntt A G 19: 41,053,149 E424G probably benign Het
Fam149a A G 8: 45,345,008 L492P probably damaging Het
Fetub T C 16: 22,935,660 Y126H possibly damaging Het
Fgfr3 A T 5: 33,732,782 Y96F probably damaging Het
Gm4952 A G 19: 12,624,672 E148G probably benign Het
Gucy2g T A 19: 55,203,087 L977F probably benign Het
Il1r1 T C 1: 40,282,246 V6A probably benign Het
Itsn2 C A 12: 4,658,189 Q832K probably benign Het
Lats1 T A 10: 7,712,661 F1014Y probably damaging Het
Mcc G A 18: 44,473,756 A536V probably damaging Het
Olfr1179 T C 2: 88,402,383 T184A probably benign Het
Olfr325 T A 11: 58,581,348 M168K probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr50 T A 2: 36,794,107 Y290* probably null Het
Pard6g A G 18: 80,117,208 S179G probably damaging Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Psg27 A T 7: 18,557,072 V402D probably damaging Het
Rttn A G 18: 88,977,758 I222V probably damaging Het
Sp9 T A 2: 73,273,638 S179T probably benign Het
Tbc1d8 T A 1: 39,405,326 H184L probably damaging Het
Vmn1r69 A G 7: 10,580,654 V50A probably benign Het
Vmn2r58 A G 7: 41,860,576 F526L possibly damaging Het
Other mutations in Mtrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Mtrf1 APN 14 79423425 missense probably benign 0.10
IGL01478:Mtrf1 APN 14 79402920 splice site probably benign
IGL01866:Mtrf1 APN 14 79401508 missense probably benign
IGL02290:Mtrf1 APN 14 79401811 nonsense probably null
IGL02929:Mtrf1 APN 14 79402833 missense probably benign 0.00
IGL03342:Mtrf1 APN 14 79415980 missense possibly damaging 0.80
IGL03342:Mtrf1 APN 14 79415871 splice site probably benign
IGL03342:Mtrf1 APN 14 79415872 splice site probably null
R0212:Mtrf1 UTSW 14 79419279 missense probably benign 0.02
R0560:Mtrf1 UTSW 14 79406850 missense probably damaging 1.00
R0669:Mtrf1 UTSW 14 79419268 nonsense probably null
R0981:Mtrf1 UTSW 14 79401590 missense probably benign 0.04
R1837:Mtrf1 UTSW 14 79401833 missense possibly damaging 0.89
R1969:Mtrf1 UTSW 14 79401671 missense probably damaging 1.00
R3883:Mtrf1 UTSW 14 79419267 missense probably damaging 1.00
R4739:Mtrf1 UTSW 14 79413080 missense probably damaging 1.00
R4748:Mtrf1 UTSW 14 79411650 missense probably damaging 1.00
R4780:Mtrf1 UTSW 14 79401688 missense probably benign 0.02
R4965:Mtrf1 UTSW 14 79406587 missense probably benign
R5616:Mtrf1 UTSW 14 79401445 missense possibly damaging 0.68
R6530:Mtrf1 UTSW 14 79402891 missense possibly damaging 0.89
R6776:Mtrf1 UTSW 14 79413081 missense probably damaging 1.00
R7095:Mtrf1 UTSW 14 79423491 frame shift probably null
R7182:Mtrf1 UTSW 14 79423464 missense possibly damaging 0.60
R7254:Mtrf1 UTSW 14 79423491 frame shift probably null
R7871:Mtrf1 UTSW 14 79406938 missense probably benign 0.19
R8249:Mtrf1 UTSW 14 79401479 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TGTGCTAAATCTAAACGGTTGCTTGTCT -3'
(R):5'- GCATGACTGAATGCAATCAATAGCTCC -3'

Sequencing Primer
(F):5'- agctaggtatggtgcccc -3'
(R):5'- AATAGCTCCTTAGGCTACATGC -3'
Posted On2013-07-11