Incidental Mutation 'PIT4504001:Zfp455'
ID556024
Institutional Source Beutler Lab
Gene Symbol Zfp455
Ensembl Gene ENSMUSG00000051037
Gene Namezinc finger protein 455
SynonymsRslcan-10, 3732412P20Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.510) question?
Stock #PIT4504001 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location67194506-67209298 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67198621 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 32 (D32G)
Ref Sequence ENSEMBL: ENSMUSP00000112546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117110] [ENSMUST00000120861]
Predicted Effect probably benign
Transcript: ENSMUST00000117110
SMART Domains Protein: ENSMUSP00000113356
Gene: ENSMUSG00000051037

DomainStartEndE-ValueType
ZnF_C2H2 44 66 7.15e-2 SMART
ZnF_C2H2 72 94 1.6e-4 SMART
ZnF_C2H2 100 122 2.12e-4 SMART
ZnF_C2H2 128 150 6.23e-2 SMART
ZnF_C2H2 184 206 1.01e-1 SMART
ZnF_C2H2 212 234 3.11e-2 SMART
ZnF_C2H2 240 262 1.1e-2 SMART
ZnF_C2H2 268 290 1.38e-3 SMART
ZnF_C2H2 296 318 3.58e-2 SMART
ZnF_C2H2 324 346 2.24e-3 SMART
ZnF_C2H2 352 374 7.9e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120861
AA Change: D32G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112546
Gene: ENSMUSG00000051037
AA Change: D32G

DomainStartEndE-ValueType
KRAB 5 65 1.92e-34 SMART
ZnF_C2H2 109 131 7.15e-2 SMART
ZnF_C2H2 137 159 1.6e-4 SMART
ZnF_C2H2 165 187 2.12e-4 SMART
ZnF_C2H2 193 215 6.23e-2 SMART
ZnF_C2H2 249 271 1.01e-1 SMART
ZnF_C2H2 277 299 3.11e-2 SMART
ZnF_C2H2 305 327 1.1e-2 SMART
ZnF_C2H2 333 355 1.38e-3 SMART
ZnF_C2H2 361 383 3.58e-2 SMART
ZnF_C2H2 389 411 2.24e-3 SMART
ZnF_C2H2 417 439 7.9e-4 SMART
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.6%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T A 2: 103,717,192 C970* probably null Het
Adgrv1 G A 13: 81,559,352 P1312S probably damaging Het
Als2cr12 T A 1: 58,659,099 I348F probably benign Het
Arid5a T C 1: 36,317,625 I116T probably damaging Het
Bank1 C A 3: 136,100,419 D485Y probably damaging Het
Cbln3 C T 14: 55,883,499 V122M probably damaging Het
Cox10 C T 11: 63,964,216 C413Y possibly damaging Het
Ctsll3 T A 13: 60,801,009 D44V probably benign Het
Cuzd1 A T 7: 131,309,800 N483K possibly damaging Het
Dcaf4 G A 12: 83,534,011 probably null Het
Ddx60 A G 8: 61,958,113 T470A probably benign Het
Dennd1b T C 1: 139,040,004 V44A probably benign Het
Dusp16 C A 6: 134,739,883 V154F possibly damaging Het
Ect2 G A 3: 27,126,948 R586* probably null Het
Ermard T A 17: 15,058,822 C460* probably null Het
Fat2 C T 11: 55,256,110 G4020D possibly damaging Het
Galnt16 G T 12: 80,592,417 E402* probably null Het
Gm5414 T G 15: 101,625,823 D282A probably damaging Het
Gm6741 C T 17: 91,236,916 Q36* probably null Het
Gm7356 A T 17: 14,001,458 L103Q probably damaging Het
Hcn1 A G 13: 117,975,875 T792A possibly damaging Het
Hemgn T C 4: 46,395,863 N458D probably benign Het
Hesx1 C A 14: 27,001,881 D140E probably benign Het
Hfe2 A T 3: 96,528,497 D357V probably damaging Het
Hmgcr A G 13: 96,663,097 I163T possibly damaging Het
Igfbpl1 T C 4: 45,813,469 T249A possibly damaging Het
Il33 A T 19: 29,952,739 H78L probably benign Het
Inpp4b A T 8: 82,041,935 D691V probably damaging Het
Itpr2 T A 6: 146,229,871 N1945I probably damaging Het
Lnpep A G 17: 17,579,027 V122A probably benign Het
Lrp2 T C 2: 69,475,403 D2938G probably damaging Het
Lrrc8c A T 5: 105,608,537 Y726F probably benign Het
Magi3 G T 3: 104,015,526 Q1292K probably benign Het
Mllt3 A C 4: 87,774,087 F546L probably damaging Het
Mrpl14 A G 17: 45,698,221 K82R probably benign Het
Noxred1 A G 12: 87,224,879 V172A possibly damaging Het
Obscn A T 11: 59,133,122 I574N probably damaging Het
Olfr133 A G 17: 38,149,169 T194A probably benign Het
Olfr175-ps1 T A 16: 58,824,308 T134S probably benign Het
Osbpl11 T A 16: 33,234,494 V649D probably benign Het
Pdlim2 G T 14: 70,166,130 P278T probably benign Het
Pm20d2 A C 4: 33,183,152 L223V probably damaging Het
Pmpcb G T 5: 21,743,390 R223L probably damaging Het
Pole2 A T 12: 69,209,985 Y255* probably null Het
Rims1 T A 1: 22,397,460 I317L Het
Scnn1g C A 7: 121,742,331 H239N probably benign Het
Spag17 A G 3: 100,103,110 probably null Het
Tenm3 A T 8: 48,293,657 F1038I probably damaging Het
Tshz2 T C 2: 169,886,051 F856L probably damaging Het
Ubtf A G 11: 102,306,682 S715P unknown Het
Usp13 A C 3: 32,905,430 S557R probably damaging Het
Usp19 T A 9: 108,492,970 S43T probably benign Het
Vmn2r7 A T 3: 64,715,976 Y308N probably benign Het
Zfp512 T A 5: 31,476,881 probably null Het
Zfr A G 15: 12,166,158 E838G possibly damaging Het
Other mutations in Zfp455
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Zfp455 APN 13 67207898 missense probably benign 0.33
IGL03111:Zfp455 APN 13 67207999 missense probably benign 0.00
IGL03210:Zfp455 APN 13 67207049 missense possibly damaging 0.93
IGL03371:Zfp455 APN 13 67207002 nonsense probably null
R0245:Zfp455 UTSW 13 67207835 missense probably damaging 1.00
R0277:Zfp455 UTSW 13 67198664 splice site probably null
R1141:Zfp455 UTSW 13 67198591 missense probably damaging 1.00
R1266:Zfp455 UTSW 13 67206964 nonsense probably null
R1657:Zfp455 UTSW 13 67198639 missense possibly damaging 0.83
R1749:Zfp455 UTSW 13 67207009 missense probably damaging 1.00
R1757:Zfp455 UTSW 13 67207537 missense probably damaging 1.00
R1854:Zfp455 UTSW 13 67207817 missense probably damaging 1.00
R1867:Zfp455 UTSW 13 67207445 missense probably benign 0.33
R4411:Zfp455 UTSW 13 67207325 missense probably damaging 0.96
R6060:Zfp455 UTSW 13 67207193 missense probably damaging 1.00
R6544:Zfp455 UTSW 13 67207057 missense probably benign 0.33
R7132:Zfp455 UTSW 13 67199166 missense probably damaging 1.00
R7524:Zfp455 UTSW 13 67207624 missense possibly damaging 0.73
Z1176:Zfp455 UTSW 13 67207043 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGCAGAGGACTATGTATGACC -3'
(R):5'- GAGGCATGCTTCCAACACAG -3'

Sequencing Primer
(F):5'- GACCTTGTGATCTGACCCAATAGG -3'
(R):5'- CAATGACATGTTTCTTAGCTGTACAG -3'
Posted On2019-06-07