Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4504001:Hmgcr'

556026

Institutional Source

Beutler Lab

Gene Symbol

Hmgcr

Ensembl Gene

ENSMUSG00000021670

Gene Name

3-hydroxy-3-methylglutaryl-Coenzyme A reductase

Synonyms

HMG-CoAR, 3-hydroxy-3-methylglutaryl-CoA reductase, Red

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

PIT4504001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

96648967-96670936 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 96663097 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 163 (I163T)

Ref Sequence

ENSEMBL: ENSMUSP00000022176 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022176] [ENSMUST00000168855] [ENSMUST00000169196] [ENSMUST00000169966] [ENSMUST00000170287] [ENSMUST00000171537]

AlphaFold

Q01237

Predicted Effect

possibly damaging
Transcript: ENSMUST00000022176
AA Change: I163T

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000022176
Gene: ENSMUSG00000021670
AA Change: I163T

Domain	Start	End	E-Value	Type
transmembrane domain	20	37	N/A	INTRINSIC
Pfam:Patched	56	342	2.7e-11	PFAM
Pfam:Sterol-sensing	85	234	3.4e-20	PFAM
Pfam:HMG-CoA_red	490	870	2.2e-150	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000168855

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169196
AA Change: I163T

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000132749
Gene: ENSMUSG00000021670
AA Change: I163T

Domain	Start	End	E-Value	Type
transmembrane domain	20	37	N/A	INTRINSIC
transmembrane domain	57	79	N/A	INTRINSIC
Pfam:Sterol-sensing	85	210	4.7e-15	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000169966

SMART Domains

Protein: ENSMUSP00000128294
Gene: ENSMUSG00000021670

Domain	Start	End	E-Value	Type
transmembrane domain	15	37	N/A	INTRINSIC
transmembrane domain	57	79	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170287
AA Change: I163T

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000128939
Gene: ENSMUSG00000021670
AA Change: I163T

Domain	Start	End	E-Value	Type
transmembrane domain	20	37	N/A	INTRINSIC
Pfam:Patched	56	347	1.4e-11	PFAM
Pfam:Sterol-sensing	85	234	7.4e-20	PFAM
Pfam:HMG-CoA_red	488	819	1.3e-148	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171537

SMART Domains

Protein: ENSMUSP00000126959
Gene: ENSMUSG00000021670

Domain	Start	End	E-Value	Type
transmembrane domain	20	42	N/A	INTRINSIC
transmembrane domain	67	89	N/A	INTRINSIC

Coding Region Coverage

1x: 92.8%
3x: 90.6%
10x: 84.7%
20x: 71.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HMG-CoA reductase is the rate-limiting enzyme for cholesterol synthesis and is regulated via a negative feedback mechanism mediated by sterols and non-sterol metabolites derived from mevalonate, the product of the reaction catalyzed by reductase. Normally in mammalian cells this enzyme is suppressed by cholesterol derived from the internalization and degradation of low density lipoprotein (LDL) via the LDL receptor. Competitive inhibitors of the reductase induce the expression of LDL receptors in the liver, which in turn increases the catabolism of plasma LDL and lowers the plasma concentration of cholesterol, an important determinant of atherosclerosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Inactivation of both copies of this gene results in early embryonic lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abtb2	T	A	2: 103,717,192	C970*	probably null	Het
Adgrv1	G	A	13: 81,559,352	P1312S	probably damaging	Het
Als2cr12	T	A	1: 58,659,099	I348F	probably benign	Het
Arid5a	T	C	1: 36,317,625	I116T	probably damaging	Het
Bank1	C	A	3: 136,100,419	D485Y	probably damaging	Het
Cbln3	C	T	14: 55,883,499	V122M	probably damaging	Het
Cox10	C	T	11: 63,964,216	C413Y	possibly damaging	Het
Ctsll3	T	A	13: 60,801,009	D44V	probably benign	Het
Cuzd1	A	T	7: 131,309,800	N483K	possibly damaging	Het
Dcaf4	G	A	12: 83,534,011		probably null	Het
Ddx60	A	G	8: 61,958,113	T470A	probably benign	Het
Dennd1b	T	C	1: 139,040,004	V44A	probably benign	Het
Dusp16	C	A	6: 134,739,883	V154F	possibly damaging	Het
Ect2	G	A	3: 27,126,948	R586*	probably null	Het
Ermard	T	A	17: 15,058,822	C460*	probably null	Het
Fat2	C	T	11: 55,256,110	G4020D	possibly damaging	Het
Galnt16	G	T	12: 80,592,417	E402*	probably null	Het
Gm5414	T	G	15: 101,625,823	D282A	probably damaging	Het
Gm6741	C	T	17: 91,236,916	Q36*	probably null	Het
Gm7356	A	T	17: 14,001,458	L103Q	probably damaging	Het
Hcn1	A	G	13: 117,975,875	T792A	possibly damaging	Het
Hemgn	T	C	4: 46,395,863	N458D	probably benign	Het
Hesx1	C	A	14: 27,001,881	D140E	probably benign	Het
Hfe2	A	T	3: 96,528,497	D357V	probably damaging	Het
Igfbpl1	T	C	4: 45,813,469	T249A	possibly damaging	Het
Il33	A	T	19: 29,952,739	H78L	probably benign	Het
Inpp4b	A	T	8: 82,041,935	D691V	probably damaging	Het
Itpr2	T	A	6: 146,229,871	N1945I	probably damaging	Het
Lnpep	A	G	17: 17,579,027	V122A	probably benign	Het
Lrp2	T	C	2: 69,475,403	D2938G	probably damaging	Het
Lrrc8c	A	T	5: 105,608,537	Y726F	probably benign	Het
Magi3	G	T	3: 104,015,526	Q1292K	probably benign	Het
Mllt3	A	C	4: 87,774,087	F546L	probably damaging	Het
Mrpl14	A	G	17: 45,698,221	K82R	probably benign	Het
Noxred1	A	G	12: 87,224,879	V172A	possibly damaging	Het
Obscn	A	T	11: 59,133,122	I574N	probably damaging	Het
Olfr133	A	G	17: 38,149,169	T194A	probably benign	Het
Olfr175-ps1	T	A	16: 58,824,308	T134S	probably benign	Het
Osbpl11	T	A	16: 33,234,494	V649D	probably benign	Het
Pdlim2	G	T	14: 70,166,130	P278T	probably benign	Het
Pm20d2	A	C	4: 33,183,152	L223V	probably damaging	Het
Pmpcb	G	T	5: 21,743,390	R223L	probably damaging	Het
Pole2	A	T	12: 69,209,985	Y255*	probably null	Het
Rims1	T	A	1: 22,397,460	I317L		Het
Scnn1g	C	A	7: 121,742,331	H239N	probably benign	Het
Spag17	A	G	3: 100,103,110		probably null	Het
Tenm3	A	T	8: 48,293,657	F1038I	probably damaging	Het
Tshz2	T	C	2: 169,886,051	F856L	probably damaging	Het
Ubtf	A	G	11: 102,306,682	S715P	unknown	Het
Usp13	A	C	3: 32,905,430	S557R	probably damaging	Het
Usp19	T	A	9: 108,492,970	S43T	probably benign	Het
Vmn2r7	A	T	3: 64,715,976	Y308N	probably benign	Het
Zfp455	A	G	13: 67,198,621	D32G	probably damaging	Het
Zfp512	T	A	5: 31,476,881		probably null	Het
Zfr	A	G	15: 12,166,158	E838G	possibly damaging	Het

Other mutations in Hmgcr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00557:Hmgcr	APN	13	96659278	missense	probably benign
IGL01369:Hmgcr	APN	13	96666522	missense	probably null	1.00
IGL01575:Hmgcr	APN	13	96656595	missense	possibly damaging	0.56
IGL02183:Hmgcr	APN	13	96663127	missense	probably damaging	1.00
IGL02515:Hmgcr	APN	13	96666512	splice site	probably benign
IGL02716:Hmgcr	APN	13	96660012	critical splice acceptor site	probably null
IGL03278:Hmgcr	APN	13	96656762	splice site	probably benign
IGL03367:Hmgcr	APN	13	96665853	missense	probably damaging	0.98
PIT4131001:Hmgcr	UTSW	13	96659054	missense	probably damaging	1.00
R0003:Hmgcr	UTSW	13	96652145	missense	probably damaging	1.00
R0017:Hmgcr	UTSW	13	96652089	splice site	probably benign
R0017:Hmgcr	UTSW	13	96652089	splice site	probably benign
R0217:Hmgcr	UTSW	13	96651980	missense	probably damaging	1.00
R0511:Hmgcr	UTSW	13	96660143	splice site	probably null
R0707:Hmgcr	UTSW	13	96650643	unclassified	probably benign
R1301:Hmgcr	UTSW	13	96659020	missense	probably damaging	0.97
R2203:Hmgcr	UTSW	13	96656633	missense	probably damaging	1.00
R2204:Hmgcr	UTSW	13	96656633	missense	probably damaging	1.00
R2433:Hmgcr	UTSW	13	96665885	missense	probably damaging	1.00
R2938:Hmgcr	UTSW	13	96663068	missense	probably damaging	0.99
R3159:Hmgcr	UTSW	13	96665847	missense	probably damaging	1.00
R3737:Hmgcr	UTSW	13	96651063	missense	probably damaging	1.00
R3752:Hmgcr	UTSW	13	96663116	missense	probably damaging	1.00
R3837:Hmgcr	UTSW	13	96659089	missense	probably benign	0.19
R3838:Hmgcr	UTSW	13	96659089	missense	probably benign	0.19
R3839:Hmgcr	UTSW	13	96659089	missense	probably benign	0.19
R4034:Hmgcr	UTSW	13	96651063	missense	probably damaging	1.00
R4035:Hmgcr	UTSW	13	96651063	missense	probably damaging	1.00
R4210:Hmgcr	UTSW	13	96660221	missense	probably damaging	1.00
R4783:Hmgcr	UTSW	13	96666193	missense	probably damaging	1.00
R4820:Hmgcr	UTSW	13	96660192	missense	probably damaging	1.00
R5090:Hmgcr	UTSW	13	96650590	missense	probably benign
R5113:Hmgcr	UTSW	13	96656732	missense	probably benign	0.00
R5209:Hmgcr	UTSW	13	96666512	splice site	probably benign
R5354:Hmgcr	UTSW	13	96654896	missense	probably benign	0.26
R5571:Hmgcr	UTSW	13	96666663	missense	probably benign	0.11
R5804:Hmgcr	UTSW	13	96666187	missense	probably damaging	0.98
R5886:Hmgcr	UTSW	13	96660183	missense	probably damaging	1.00
R6340:Hmgcr	UTSW	13	96665858	missense	probably damaging	1.00
R6638:Hmgcr	UTSW	13	96658982	missense	probably benign
R6699:Hmgcr	UTSW	13	96660209	missense	probably damaging	1.00
R7024:Hmgcr	UTSW	13	96658910	missense	probably benign	0.10
R7061:Hmgcr	UTSW	13	96666148	missense	possibly damaging	0.64
R7284:Hmgcr	UTSW	13	96652665	missense	probably damaging	1.00
R7286:Hmgcr	UTSW	13	96666597	missense	probably damaging	1.00
R7705:Hmgcr	UTSW	13	96656723	missense	probably benign	0.01
R7709:Hmgcr	UTSW	13	96663097	missense	possibly damaging	0.95
R9034:Hmgcr	UTSW	13	96659377	missense	probably damaging	1.00
R9158:Hmgcr	UTSW	13	96655662	nonsense	probably null
R9253:Hmgcr	UTSW	13	96660137	missense	probably damaging	1.00
R9474:Hmgcr	UTSW	13	96659895	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTACCATGCACAGAGGTCCATAG -3'
(R):5'- ACTGCCCGCTCTGACTATTG -3'

Sequencing Primer
(F):5'- ATATCCCCGTTCAAGTCACTCAGG -3'
(R):5'- GCCCGCTCTGACTATTGAATGC -3'

Posted On

2019-06-07