Incidental Mutation 'PIT4504001:Hmgcr'
ID556026
Institutional Source Beutler Lab
Gene Symbol Hmgcr
Ensembl Gene ENSMUSG00000021670
Gene Name3-hydroxy-3-methylglutaryl-Coenzyme A reductase
SynonymsHMG-CoAR, 3-hydroxy-3-methylglutaryl-CoA reductase, Red
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4504001 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location96648967-96670936 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96663097 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 163 (I163T)
Ref Sequence ENSEMBL: ENSMUSP00000022176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022176] [ENSMUST00000168855] [ENSMUST00000169196] [ENSMUST00000169966] [ENSMUST00000170287] [ENSMUST00000171537]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022176
AA Change: I163T

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000022176
Gene: ENSMUSG00000021670
AA Change: I163T

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
Pfam:Patched 56 342 2.7e-11 PFAM
Pfam:Sterol-sensing 85 234 3.4e-20 PFAM
Pfam:HMG-CoA_red 490 870 2.2e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168855
Predicted Effect possibly damaging
Transcript: ENSMUST00000169196
AA Change: I163T

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000132749
Gene: ENSMUSG00000021670
AA Change: I163T

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
Pfam:Sterol-sensing 85 210 4.7e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169966
SMART Domains Protein: ENSMUSP00000128294
Gene: ENSMUSG00000021670

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170287
AA Change: I163T

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000128939
Gene: ENSMUSG00000021670
AA Change: I163T

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
Pfam:Patched 56 347 1.4e-11 PFAM
Pfam:Sterol-sensing 85 234 7.4e-20 PFAM
Pfam:HMG-CoA_red 488 819 1.3e-148 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171537
SMART Domains Protein: ENSMUSP00000126959
Gene: ENSMUSG00000021670

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 67 89 N/A INTRINSIC
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.6%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HMG-CoA reductase is the rate-limiting enzyme for cholesterol synthesis and is regulated via a negative feedback mechanism mediated by sterols and non-sterol metabolites derived from mevalonate, the product of the reaction catalyzed by reductase. Normally in mammalian cells this enzyme is suppressed by cholesterol derived from the internalization and degradation of low density lipoprotein (LDL) via the LDL receptor. Competitive inhibitors of the reductase induce the expression of LDL receptors in the liver, which in turn increases the catabolism of plasma LDL and lowers the plasma concentration of cholesterol, an important determinant of atherosclerosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Inactivation of both copies of this gene results in early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T A 2: 103,717,192 C970* probably null Het
Adgrv1 G A 13: 81,559,352 P1312S probably damaging Het
Als2cr12 T A 1: 58,659,099 I348F probably benign Het
Arid5a T C 1: 36,317,625 I116T probably damaging Het
Bank1 C A 3: 136,100,419 D485Y probably damaging Het
Cbln3 C T 14: 55,883,499 V122M probably damaging Het
Cox10 C T 11: 63,964,216 C413Y possibly damaging Het
Ctsll3 T A 13: 60,801,009 D44V probably benign Het
Cuzd1 A T 7: 131,309,800 N483K possibly damaging Het
Dcaf4 G A 12: 83,534,011 probably null Het
Ddx60 A G 8: 61,958,113 T470A probably benign Het
Dennd1b T C 1: 139,040,004 V44A probably benign Het
Dusp16 C A 6: 134,739,883 V154F possibly damaging Het
Ect2 G A 3: 27,126,948 R586* probably null Het
Ermard T A 17: 15,058,822 C460* probably null Het
Fat2 C T 11: 55,256,110 G4020D possibly damaging Het
Galnt16 G T 12: 80,592,417 E402* probably null Het
Gm5414 T G 15: 101,625,823 D282A probably damaging Het
Gm6741 C T 17: 91,236,916 Q36* probably null Het
Gm7356 A T 17: 14,001,458 L103Q probably damaging Het
Hcn1 A G 13: 117,975,875 T792A possibly damaging Het
Hemgn T C 4: 46,395,863 N458D probably benign Het
Hesx1 C A 14: 27,001,881 D140E probably benign Het
Hfe2 A T 3: 96,528,497 D357V probably damaging Het
Igfbpl1 T C 4: 45,813,469 T249A possibly damaging Het
Il33 A T 19: 29,952,739 H78L probably benign Het
Inpp4b A T 8: 82,041,935 D691V probably damaging Het
Itpr2 T A 6: 146,229,871 N1945I probably damaging Het
Lnpep A G 17: 17,579,027 V122A probably benign Het
Lrp2 T C 2: 69,475,403 D2938G probably damaging Het
Lrrc8c A T 5: 105,608,537 Y726F probably benign Het
Magi3 G T 3: 104,015,526 Q1292K probably benign Het
Mllt3 A C 4: 87,774,087 F546L probably damaging Het
Mrpl14 A G 17: 45,698,221 K82R probably benign Het
Noxred1 A G 12: 87,224,879 V172A possibly damaging Het
Obscn A T 11: 59,133,122 I574N probably damaging Het
Olfr133 A G 17: 38,149,169 T194A probably benign Het
Olfr175-ps1 T A 16: 58,824,308 T134S probably benign Het
Osbpl11 T A 16: 33,234,494 V649D probably benign Het
Pdlim2 G T 14: 70,166,130 P278T probably benign Het
Pm20d2 A C 4: 33,183,152 L223V probably damaging Het
Pmpcb G T 5: 21,743,390 R223L probably damaging Het
Pole2 A T 12: 69,209,985 Y255* probably null Het
Rims1 T A 1: 22,397,460 I317L Het
Scnn1g C A 7: 121,742,331 H239N probably benign Het
Spag17 A G 3: 100,103,110 probably null Het
Tenm3 A T 8: 48,293,657 F1038I probably damaging Het
Tshz2 T C 2: 169,886,051 F856L probably damaging Het
Ubtf A G 11: 102,306,682 S715P unknown Het
Usp13 A C 3: 32,905,430 S557R probably damaging Het
Usp19 T A 9: 108,492,970 S43T probably benign Het
Vmn2r7 A T 3: 64,715,976 Y308N probably benign Het
Zfp455 A G 13: 67,198,621 D32G probably damaging Het
Zfp512 T A 5: 31,476,881 probably null Het
Zfr A G 15: 12,166,158 E838G possibly damaging Het
Other mutations in Hmgcr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Hmgcr APN 13 96659278 missense probably benign
IGL01369:Hmgcr APN 13 96666522 missense probably null 1.00
IGL01575:Hmgcr APN 13 96656595 missense possibly damaging 0.56
IGL02183:Hmgcr APN 13 96663127 missense probably damaging 1.00
IGL02515:Hmgcr APN 13 96666512 splice site probably benign
IGL02716:Hmgcr APN 13 96660012 critical splice acceptor site probably null
IGL03278:Hmgcr APN 13 96656762 splice site probably benign
IGL03367:Hmgcr APN 13 96665853 missense probably damaging 0.98
PIT4131001:Hmgcr UTSW 13 96659054 missense probably damaging 1.00
R0003:Hmgcr UTSW 13 96652145 missense probably damaging 1.00
R0017:Hmgcr UTSW 13 96652089 splice site probably benign
R0017:Hmgcr UTSW 13 96652089 splice site probably benign
R0217:Hmgcr UTSW 13 96651980 missense probably damaging 1.00
R0511:Hmgcr UTSW 13 96660143 splice site probably null
R0707:Hmgcr UTSW 13 96650643 unclassified probably benign
R1301:Hmgcr UTSW 13 96659020 missense probably damaging 0.97
R2203:Hmgcr UTSW 13 96656633 missense probably damaging 1.00
R2204:Hmgcr UTSW 13 96656633 missense probably damaging 1.00
R2433:Hmgcr UTSW 13 96665885 missense probably damaging 1.00
R2938:Hmgcr UTSW 13 96663068 missense probably damaging 0.99
R3159:Hmgcr UTSW 13 96665847 missense probably damaging 1.00
R3737:Hmgcr UTSW 13 96651063 missense probably damaging 1.00
R3752:Hmgcr UTSW 13 96663116 missense probably damaging 1.00
R3837:Hmgcr UTSW 13 96659089 missense probably benign 0.19
R3838:Hmgcr UTSW 13 96659089 missense probably benign 0.19
R3839:Hmgcr UTSW 13 96659089 missense probably benign 0.19
R4034:Hmgcr UTSW 13 96651063 missense probably damaging 1.00
R4035:Hmgcr UTSW 13 96651063 missense probably damaging 1.00
R4210:Hmgcr UTSW 13 96660221 missense probably damaging 1.00
R4783:Hmgcr UTSW 13 96666193 missense probably damaging 1.00
R4820:Hmgcr UTSW 13 96660192 missense probably damaging 1.00
R5090:Hmgcr UTSW 13 96650590 missense probably benign
R5113:Hmgcr UTSW 13 96656732 missense probably benign 0.00
R5209:Hmgcr UTSW 13 96666512 splice site probably benign
R5354:Hmgcr UTSW 13 96654896 missense probably benign 0.26
R5571:Hmgcr UTSW 13 96666663 missense probably benign 0.11
R5804:Hmgcr UTSW 13 96666187 missense probably damaging 0.98
R5886:Hmgcr UTSW 13 96660183 missense probably damaging 1.00
R6340:Hmgcr UTSW 13 96665858 missense probably damaging 1.00
R6638:Hmgcr UTSW 13 96658982 missense probably benign
R6699:Hmgcr UTSW 13 96660209 missense probably damaging 1.00
R7024:Hmgcr UTSW 13 96658910 missense probably benign 0.10
R7061:Hmgcr UTSW 13 96666148 missense possibly damaging 0.64
R7284:Hmgcr UTSW 13 96652665 missense probably damaging 1.00
R7286:Hmgcr UTSW 13 96666597 missense probably damaging 1.00
R7705:Hmgcr UTSW 13 96656723 missense probably benign 0.01
R7709:Hmgcr UTSW 13 96663097 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTTACCATGCACAGAGGTCCATAG -3'
(R):5'- ACTGCCCGCTCTGACTATTG -3'

Sequencing Primer
(F):5'- ATATCCCCGTTCAAGTCACTCAGG -3'
(R):5'- GCCCGCTCTGACTATTGAATGC -3'
Posted On2019-06-07