Incidental Mutation 'PIT4504001:Hcn1'
ID556027
Institutional Source Beutler Lab
Gene Symbol Hcn1
Ensembl Gene ENSMUSG00000021730
Gene Namehyperpolarization-activated, cyclic nucleotide-gated K+ 1
SynonymsHAC2, Bcng1, C630013B14Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4504001 (G1)
Quality Score94.0186
Status Not validated
Chromosome13
Chromosomal Location117602320-117987418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117975875 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 792 (T792A)
Ref Sequence ENSEMBL: ENSMUSP00000006991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006991]
PDB Structure
Tetramerization dynamics of the C-terminus underlies isoform-specific cAMP-gating in HCN channels [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006991
AA Change: T792A

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000006991
Gene: ENSMUSG00000021730
AA Change: T792A

DomainStartEndE-ValueType
Pfam:Ion_trans_N 87 130 8.2e-24 PFAM
Pfam:Ion_trans 131 394 2.1e-23 PFAM
low complexity region 395 406 N/A INTRINSIC
Blast:cNMP 407 439 4e-13 BLAST
cNMP 464 580 1.95e-22 SMART
low complexity region 639 655 N/A INTRINSIC
low complexity region 660 680 N/A INTRINSIC
low complexity region 720 779 N/A INTRINSIC
low complexity region 878 886 N/A INTRINSIC
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.6%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane protein encoded by this gene is a hyperpolarization-activated cation channel that contributes to the native pacemaker currents in heart and neurons. The encoded protein can homodimerize or heterodimerize with other pore-forming subunits to form a potassium channel. This channel may act as a receptor for sour tastes. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for disruptions in this allele display learning deficiencies but are otherwise normal. Mice homozygous for another targeted knock-out exhibit deficit in hyperpolarization-activated currents and cold allodynia following partial nerve ligation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T A 2: 103,717,192 C970* probably null Het
Adgrv1 G A 13: 81,559,352 P1312S probably damaging Het
Als2cr12 T A 1: 58,659,099 I348F probably benign Het
Arid5a T C 1: 36,317,625 I116T probably damaging Het
Bank1 C A 3: 136,100,419 D485Y probably damaging Het
Cbln3 C T 14: 55,883,499 V122M probably damaging Het
Cox10 C T 11: 63,964,216 C413Y possibly damaging Het
Ctsll3 T A 13: 60,801,009 D44V probably benign Het
Cuzd1 A T 7: 131,309,800 N483K possibly damaging Het
Dcaf4 G A 12: 83,534,011 probably null Het
Ddx60 A G 8: 61,958,113 T470A probably benign Het
Dennd1b T C 1: 139,040,004 V44A probably benign Het
Dusp16 C A 6: 134,739,883 V154F possibly damaging Het
Ect2 G A 3: 27,126,948 R586* probably null Het
Ermard T A 17: 15,058,822 C460* probably null Het
Fat2 C T 11: 55,256,110 G4020D possibly damaging Het
Galnt16 G T 12: 80,592,417 E402* probably null Het
Gm5414 T G 15: 101,625,823 D282A probably damaging Het
Gm6741 C T 17: 91,236,916 Q36* probably null Het
Gm7356 A T 17: 14,001,458 L103Q probably damaging Het
Hemgn T C 4: 46,395,863 N458D probably benign Het
Hesx1 C A 14: 27,001,881 D140E probably benign Het
Hfe2 A T 3: 96,528,497 D357V probably damaging Het
Hmgcr A G 13: 96,663,097 I163T possibly damaging Het
Igfbpl1 T C 4: 45,813,469 T249A possibly damaging Het
Il33 A T 19: 29,952,739 H78L probably benign Het
Inpp4b A T 8: 82,041,935 D691V probably damaging Het
Itpr2 T A 6: 146,229,871 N1945I probably damaging Het
Lnpep A G 17: 17,579,027 V122A probably benign Het
Lrp2 T C 2: 69,475,403 D2938G probably damaging Het
Lrrc8c A T 5: 105,608,537 Y726F probably benign Het
Magi3 G T 3: 104,015,526 Q1292K probably benign Het
Mllt3 A C 4: 87,774,087 F546L probably damaging Het
Mrpl14 A G 17: 45,698,221 K82R probably benign Het
Noxred1 A G 12: 87,224,879 V172A possibly damaging Het
Obscn A T 11: 59,133,122 I574N probably damaging Het
Olfr133 A G 17: 38,149,169 T194A probably benign Het
Olfr175-ps1 T A 16: 58,824,308 T134S probably benign Het
Osbpl11 T A 16: 33,234,494 V649D probably benign Het
Pdlim2 G T 14: 70,166,130 P278T probably benign Het
Pm20d2 A C 4: 33,183,152 L223V probably damaging Het
Pmpcb G T 5: 21,743,390 R223L probably damaging Het
Pole2 A T 12: 69,209,985 Y255* probably null Het
Rims1 T A 1: 22,397,460 I317L Het
Scnn1g C A 7: 121,742,331 H239N probably benign Het
Spag17 A G 3: 100,103,110 probably null Het
Tenm3 A T 8: 48,293,657 F1038I probably damaging Het
Tshz2 T C 2: 169,886,051 F856L probably damaging Het
Ubtf A G 11: 102,306,682 S715P unknown Het
Usp13 A C 3: 32,905,430 S557R probably damaging Het
Usp19 T A 9: 108,492,970 S43T probably benign Het
Vmn2r7 A T 3: 64,715,976 Y308N probably benign Het
Zfp455 A G 13: 67,198,621 D32G probably damaging Het
Zfp512 T A 5: 31,476,881 probably null Het
Zfr A G 15: 12,166,158 E838G possibly damaging Het
Other mutations in Hcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Hcn1 APN 13 117975993 missense probably damaging 1.00
IGL00340:Hcn1 APN 13 117602977 missense unknown
IGL01161:Hcn1 APN 13 117656922 missense unknown
IGL01723:Hcn1 APN 13 117976055 missense probably damaging 0.98
IGL02324:Hcn1 APN 13 117902886 missense unknown
IGL02491:Hcn1 APN 13 117810040 missense unknown
Thump UTSW 13 117873905 nonsense probably null
FR4976:Hcn1 UTSW 13 117975808 small insertion probably benign
R0420:Hcn1 UTSW 13 117975375 missense unknown
R1546:Hcn1 UTSW 13 117975766 small insertion probably benign
R1558:Hcn1 UTSW 13 117975576 missense unknown
R1659:Hcn1 UTSW 13 117976074 missense probably damaging 0.99
R1667:Hcn1 UTSW 13 117603073 missense unknown
R1766:Hcn1 UTSW 13 117656734 missense probably benign 0.39
R1842:Hcn1 UTSW 13 117976008 missense probably damaging 0.99
R2051:Hcn1 UTSW 13 117976083 missense probably damaging 0.99
R3605:Hcn1 UTSW 13 117975252 missense unknown
R4259:Hcn1 UTSW 13 117975348 missense unknown
R4284:Hcn1 UTSW 13 117975733 small deletion probably benign
R4637:Hcn1 UTSW 13 117975713 missense unknown
R4679:Hcn1 UTSW 13 117657015 missense probably benign 0.39
R4777:Hcn1 UTSW 13 117975733 small deletion probably benign
R4839:Hcn1 UTSW 13 117925710 missense unknown
R4883:Hcn1 UTSW 13 117902895 critical splice donor site probably null
R5015:Hcn1 UTSW 13 117603020 missense unknown
R5060:Hcn1 UTSW 13 117873905 nonsense probably null
R5748:Hcn1 UTSW 13 117976055 missense probably damaging 0.99
R5823:Hcn1 UTSW 13 117602852 missense unknown
R6900:Hcn1 UTSW 13 117656827 missense probably benign 0.39
R7045:Hcn1 UTSW 13 117975462 missense unknown
R7049:Hcn1 UTSW 13 117975462 missense unknown
R7163:Hcn1 UTSW 13 117925547 missense unknown
R7534:Hcn1 UTSW 13 117975425 missense unknown
R7722:Hcn1 UTSW 13 117902778 missense unknown
R8083:Hcn1 UTSW 13 117975760 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GGTACAGCAGACTCAGACTCAG -3'
(R):5'- TCGGAACAAGGTGACACGTTG -3'

Sequencing Primer
(F):5'- TCAGACTCAGCAGCAGCAG -3'
(R):5'- ACACGTTGTGGCACTGTGC -3'
Posted On2019-06-07