Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4504001:Hcn1'

556027

Institutional Source

Beutler Lab

Gene Symbol

Hcn1

Ensembl Gene

ENSMUSG00000021730

Gene Name

hyperpolarization-activated, cyclic nucleotide-gated K+ 1

Synonyms

HAC2, Bcng1, C630013B14Rik

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

PIT4504001 (G1)

Quality Score

94.0186

Status

Not validated

Chromosome

Chromosomal Location

117602320-117987418 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 117975875 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 792 (T792A)

Ref Sequence

ENSEMBL: ENSMUSP00000006991 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006991]

AlphaFold

O88704

PDB Structure

Tetramerization dynamics of the C-terminus underlies isoform-specific cAMP-gating in HCN channels [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000006991
AA Change: T792A

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000006991
Gene: ENSMUSG00000021730
AA Change: T792A

Domain	Start	End	E-Value	Type
Pfam:Ion_trans_N	87	130	8.2e-24	PFAM
Pfam:Ion_trans	131	394	2.1e-23	PFAM
low complexity region	395	406	N/A	INTRINSIC
Blast:cNMP	407	439	4e-13	BLAST
cNMP	464	580	1.95e-22	SMART
low complexity region	639	655	N/A	INTRINSIC
low complexity region	660	680	N/A	INTRINSIC
low complexity region	720	779	N/A	INTRINSIC
low complexity region	878	886	N/A	INTRINSIC

Coding Region Coverage

1x: 92.8%
3x: 90.6%
10x: 84.7%
20x: 71.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane protein encoded by this gene is a hyperpolarization-activated cation channel that contributes to the native pacemaker currents in heart and neurons. The encoded protein can homodimerize or heterodimerize with other pore-forming subunits to form a potassium channel. This channel may act as a receptor for sour tastes. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for disruptions in this allele display learning deficiencies but are otherwise normal. Mice homozygous for another targeted knock-out exhibit deficit in hyperpolarization-activated currents and cold allodynia following partial nerve ligation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abtb2	T	A	2: 103,717,192	C970*	probably null	Het
Adgrv1	G	A	13: 81,559,352	P1312S	probably damaging	Het
Als2cr12	T	A	1: 58,659,099	I348F	probably benign	Het
Arid5a	T	C	1: 36,317,625	I116T	probably damaging	Het
Bank1	C	A	3: 136,100,419	D485Y	probably damaging	Het
Cbln3	C	T	14: 55,883,499	V122M	probably damaging	Het
Cox10	C	T	11: 63,964,216	C413Y	possibly damaging	Het
Ctsll3	T	A	13: 60,801,009	D44V	probably benign	Het
Cuzd1	A	T	7: 131,309,800	N483K	possibly damaging	Het
Dcaf4	G	A	12: 83,534,011		probably null	Het
Ddx60	A	G	8: 61,958,113	T470A	probably benign	Het
Dennd1b	T	C	1: 139,040,004	V44A	probably benign	Het
Dusp16	C	A	6: 134,739,883	V154F	possibly damaging	Het
Ect2	G	A	3: 27,126,948	R586*	probably null	Het
Ermard	T	A	17: 15,058,822	C460*	probably null	Het
Fat2	C	T	11: 55,256,110	G4020D	possibly damaging	Het
Galnt16	G	T	12: 80,592,417	E402*	probably null	Het
Gm5414	T	G	15: 101,625,823	D282A	probably damaging	Het
Gm6741	C	T	17: 91,236,916	Q36*	probably null	Het
Gm7356	A	T	17: 14,001,458	L103Q	probably damaging	Het
Hemgn	T	C	4: 46,395,863	N458D	probably benign	Het
Hesx1	C	A	14: 27,001,881	D140E	probably benign	Het
Hfe2	A	T	3: 96,528,497	D357V	probably damaging	Het
Hmgcr	A	G	13: 96,663,097	I163T	possibly damaging	Het
Igfbpl1	T	C	4: 45,813,469	T249A	possibly damaging	Het
Il33	A	T	19: 29,952,739	H78L	probably benign	Het
Inpp4b	A	T	8: 82,041,935	D691V	probably damaging	Het
Itpr2	T	A	6: 146,229,871	N1945I	probably damaging	Het
Lnpep	A	G	17: 17,579,027	V122A	probably benign	Het
Lrp2	T	C	2: 69,475,403	D2938G	probably damaging	Het
Lrrc8c	A	T	5: 105,608,537	Y726F	probably benign	Het
Magi3	G	T	3: 104,015,526	Q1292K	probably benign	Het
Mllt3	A	C	4: 87,774,087	F546L	probably damaging	Het
Mrpl14	A	G	17: 45,698,221	K82R	probably benign	Het
Noxred1	A	G	12: 87,224,879	V172A	possibly damaging	Het
Obscn	A	T	11: 59,133,122	I574N	probably damaging	Het
Olfr133	A	G	17: 38,149,169	T194A	probably benign	Het
Olfr175-ps1	T	A	16: 58,824,308	T134S	probably benign	Het
Osbpl11	T	A	16: 33,234,494	V649D	probably benign	Het
Pdlim2	G	T	14: 70,166,130	P278T	probably benign	Het
Pm20d2	A	C	4: 33,183,152	L223V	probably damaging	Het
Pmpcb	G	T	5: 21,743,390	R223L	probably damaging	Het
Pole2	A	T	12: 69,209,985	Y255*	probably null	Het
Rims1	T	A	1: 22,397,460	I317L		Het
Scnn1g	C	A	7: 121,742,331	H239N	probably benign	Het
Spag17	A	G	3: 100,103,110		probably null	Het
Tenm3	A	T	8: 48,293,657	F1038I	probably damaging	Het
Tshz2	T	C	2: 169,886,051	F856L	probably damaging	Het
Ubtf	A	G	11: 102,306,682	S715P	unknown	Het
Usp13	A	C	3: 32,905,430	S557R	probably damaging	Het
Usp19	T	A	9: 108,492,970	S43T	probably benign	Het
Vmn2r7	A	T	3: 64,715,976	Y308N	probably benign	Het
Zfp455	A	G	13: 67,198,621	D32G	probably damaging	Het
Zfp512	T	A	5: 31,476,881		probably null	Het
Zfr	A	G	15: 12,166,158	E838G	possibly damaging	Het

Other mutations in Hcn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Hcn1	APN	13	117975993	missense	probably damaging	1.00
IGL00340:Hcn1	APN	13	117602977	missense	unknown
IGL01161:Hcn1	APN	13	117656922	missense	unknown
IGL01723:Hcn1	APN	13	117976055	missense	probably damaging	0.98
IGL02324:Hcn1	APN	13	117902886	missense	unknown
IGL02491:Hcn1	APN	13	117810040	missense	unknown
Thump	UTSW	13	117873905	nonsense	probably null
FR4976:Hcn1	UTSW	13	117975808	small insertion	probably benign
R0420:Hcn1	UTSW	13	117975375	missense	unknown
R1546:Hcn1	UTSW	13	117975766	small insertion	probably benign
R1558:Hcn1	UTSW	13	117975576	missense	unknown
R1659:Hcn1	UTSW	13	117976074	missense	probably damaging	0.99
R1667:Hcn1	UTSW	13	117603073	missense	unknown
R1766:Hcn1	UTSW	13	117656734	missense	probably benign	0.39
R1842:Hcn1	UTSW	13	117976008	missense	probably damaging	0.99
R2051:Hcn1	UTSW	13	117976083	missense	probably damaging	0.99
R3605:Hcn1	UTSW	13	117975252	missense	unknown
R4259:Hcn1	UTSW	13	117975348	missense	unknown
R4284:Hcn1	UTSW	13	117975733	small deletion	probably benign
R4637:Hcn1	UTSW	13	117975713	missense	unknown
R4679:Hcn1	UTSW	13	117657015	missense	probably benign	0.39
R4777:Hcn1	UTSW	13	117975733	small deletion	probably benign
R4839:Hcn1	UTSW	13	117925710	missense	unknown
R4883:Hcn1	UTSW	13	117902895	critical splice donor site	probably null
R5015:Hcn1	UTSW	13	117603020	missense	unknown
R5060:Hcn1	UTSW	13	117873905	nonsense	probably null
R5748:Hcn1	UTSW	13	117976055	missense	probably damaging	0.99
R5823:Hcn1	UTSW	13	117602852	missense	unknown
R6900:Hcn1	UTSW	13	117656827	missense	probably benign	0.39
R7045:Hcn1	UTSW	13	117975462	missense	unknown
R7049:Hcn1	UTSW	13	117975462	missense	unknown
R7163:Hcn1	UTSW	13	117925547	missense	unknown
R7534:Hcn1	UTSW	13	117975425	missense	unknown
R7722:Hcn1	UTSW	13	117902778	missense	unknown
R7984:Hcn1	UTSW	13	117976073	nonsense	probably null
R8083:Hcn1	UTSW	13	117975760	small insertion	probably benign
R8171:Hcn1	UTSW	13	117602734	missense	unknown
R8223:Hcn1	UTSW	13	117873870	missense	unknown
R8240:Hcn1	UTSW	13	117975733	small deletion	probably benign
R8853:Hcn1	UTSW	13	117975733	small deletion	probably benign
R9054:Hcn1	UTSW	13	117971635	missense	unknown
R9224:Hcn1	UTSW	13	117925718	missense	unknown
R9241:Hcn1	UTSW	13	117656713	missense	probably benign	0.39
R9324:Hcn1	UTSW	13	117975365	missense	unknown
R9632:Hcn1	UTSW	13	117873986	missense	probably benign	0.39
R9758:Hcn1	UTSW	13	117975769	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- GGTACAGCAGACTCAGACTCAG -3'
(R):5'- TCGGAACAAGGTGACACGTTG -3'

Sequencing Primer
(F):5'- TCAGACTCAGCAGCAGCAG -3'
(R):5'- ACACGTTGTGGCACTGTGC -3'

Posted On

2019-06-07