Incidental Mutation 'PIT4504001:Pdlim2'
ID556030
Institutional Source Beutler Lab
Gene Symbol Pdlim2
Ensembl Gene ENSMUSG00000022090
Gene NamePDZ and LIM domain 2
SynonymsSLIM, 4732462F18Rik, mystique
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #PIT4504001 (G1)
Quality Score121.008
Status Not validated
Chromosome14
Chromosomal Location70164218-70177681 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 70166130 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 278 (P278T)
Ref Sequence ENSEMBL: ENSMUSP00000022681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022681] [ENSMUST00000127836] [ENSMUST00000129174] [ENSMUST00000143393] [ENSMUST00000153735]
PDB Structure Solution structure of the PDZ domain of PDZ and LIM domain 2 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000022681
AA Change: P278T

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000022681
Gene: ENSMUSG00000022090
AA Change: P278T

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
Pfam:DUF4749 169 256 4.4e-12 PFAM
low complexity region 259 271 N/A INTRINSIC
LIM 282 334 1.25e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125300
AA Change: P79T

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116694
Gene: ENSMUSG00000022090
AA Change: P79T

DomainStartEndE-ValueType
Pfam:DUF4749 7 58 6.4e-13 PFAM
low complexity region 61 73 N/A INTRINSIC
LIM 84 136 1.25e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127836
AA Change: P57T

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141050
Gene: ENSMUSG00000022090
AA Change: P57T

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
LIM 61 113 5.9e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129174
AA Change: P57T

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139820
Gene: ENSMUSG00000022090
AA Change: P57T

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
LIM 61 113 5.9e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143393
SMART Domains Protein: ENSMUSP00000119222
Gene: ENSMUSG00000022090

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
low complexity region 199 210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153735
AA Change: P278T

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116200
Gene: ENSMUSG00000022090
AA Change: P278T

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
low complexity region 199 210 N/A INTRINSIC
low complexity region 241 250 N/A INTRINSIC
low complexity region 259 271 N/A INTRINSIC
LIM 282 334 1.25e-6 SMART
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.6%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ALP subfamily of PDZ-LIM domain proteins. The encoded protein suppresses anchorage-dependent growth and promotes cell migration and adhesion through interactions with the actin cytoskeleton via the PDZ domain. The encoded protein is also a putative tumor suppressor protein, and decreased expression of this gene is associated with several malignancies including breast cancer and adult T-cell leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele display increased IFN-gamma production by Th1 cells and an enhanced inflammatory response to in vivo challenge with heat-killed Listeria monocytogenes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T A 2: 103,717,192 C970* probably null Het
Adgrv1 G A 13: 81,559,352 P1312S probably damaging Het
Als2cr12 T A 1: 58,659,099 I348F probably benign Het
Arid5a T C 1: 36,317,625 I116T probably damaging Het
Bank1 C A 3: 136,100,419 D485Y probably damaging Het
Cbln3 C T 14: 55,883,499 V122M probably damaging Het
Cox10 C T 11: 63,964,216 C413Y possibly damaging Het
Ctsll3 T A 13: 60,801,009 D44V probably benign Het
Cuzd1 A T 7: 131,309,800 N483K possibly damaging Het
Dcaf4 G A 12: 83,534,011 probably null Het
Ddx60 A G 8: 61,958,113 T470A probably benign Het
Dennd1b T C 1: 139,040,004 V44A probably benign Het
Dusp16 C A 6: 134,739,883 V154F possibly damaging Het
Ect2 G A 3: 27,126,948 R586* probably null Het
Ermard T A 17: 15,058,822 C460* probably null Het
Fat2 C T 11: 55,256,110 G4020D possibly damaging Het
Galnt16 G T 12: 80,592,417 E402* probably null Het
Gm5414 T G 15: 101,625,823 D282A probably damaging Het
Gm6741 C T 17: 91,236,916 Q36* probably null Het
Gm7356 A T 17: 14,001,458 L103Q probably damaging Het
Hcn1 A G 13: 117,975,875 T792A possibly damaging Het
Hemgn T C 4: 46,395,863 N458D probably benign Het
Hesx1 C A 14: 27,001,881 D140E probably benign Het
Hfe2 A T 3: 96,528,497 D357V probably damaging Het
Hmgcr A G 13: 96,663,097 I163T possibly damaging Het
Igfbpl1 T C 4: 45,813,469 T249A possibly damaging Het
Il33 A T 19: 29,952,739 H78L probably benign Het
Inpp4b A T 8: 82,041,935 D691V probably damaging Het
Itpr2 T A 6: 146,229,871 N1945I probably damaging Het
Lnpep A G 17: 17,579,027 V122A probably benign Het
Lrp2 T C 2: 69,475,403 D2938G probably damaging Het
Lrrc8c A T 5: 105,608,537 Y726F probably benign Het
Magi3 G T 3: 104,015,526 Q1292K probably benign Het
Mllt3 A C 4: 87,774,087 F546L probably damaging Het
Mrpl14 A G 17: 45,698,221 K82R probably benign Het
Noxred1 A G 12: 87,224,879 V172A possibly damaging Het
Obscn A T 11: 59,133,122 I574N probably damaging Het
Olfr133 A G 17: 38,149,169 T194A probably benign Het
Olfr175-ps1 T A 16: 58,824,308 T134S probably benign Het
Osbpl11 T A 16: 33,234,494 V649D probably benign Het
Pm20d2 A C 4: 33,183,152 L223V probably damaging Het
Pmpcb G T 5: 21,743,390 R223L probably damaging Het
Pole2 A T 12: 69,209,985 Y255* probably null Het
Rims1 T A 1: 22,397,460 I317L Het
Scnn1g C A 7: 121,742,331 H239N probably benign Het
Spag17 A G 3: 100,103,110 probably null Het
Tenm3 A T 8: 48,293,657 F1038I probably damaging Het
Tshz2 T C 2: 169,886,051 F856L probably damaging Het
Ubtf A G 11: 102,306,682 S715P unknown Het
Usp13 A C 3: 32,905,430 S557R probably damaging Het
Usp19 T A 9: 108,492,970 S43T probably benign Het
Vmn2r7 A T 3: 64,715,976 Y308N probably benign Het
Zfp455 A G 13: 67,198,621 D32G probably damaging Het
Zfp512 T A 5: 31,476,881 probably null Het
Zfr A G 15: 12,166,158 E838G possibly damaging Het
Other mutations in Pdlim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02295:Pdlim2 APN 14 70166083 splice site probably benign
IGL02338:Pdlim2 APN 14 70174457 missense probably damaging 1.00
IGL03286:Pdlim2 APN 14 70174476 missense possibly damaging 0.88
R0751:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R0768:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R0832:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1167:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1207:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1207:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1343:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1412:Pdlim2 UTSW 14 70174324 splice site probably benign
R1595:Pdlim2 UTSW 14 70164744 missense probably damaging 1.00
R1689:Pdlim2 UTSW 14 70171239 missense probably damaging 0.98
R1703:Pdlim2 UTSW 14 70174335 critical splice donor site probably null
R1843:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1845:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1923:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1924:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1925:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R2004:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R2005:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R2202:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R2205:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R2237:Pdlim2 UTSW 14 70171249 missense probably benign 0.05
R2843:Pdlim2 UTSW 14 70166100 missense probably benign 0.02
R4042:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R4965:Pdlim2 UTSW 14 70168015 unclassified probably benign
R4971:Pdlim2 UTSW 14 70167759 missense probably damaging 1.00
R5951:Pdlim2 UTSW 14 70167780 missense probably benign 0.06
R6252:Pdlim2 UTSW 14 70167688 missense probably damaging 1.00
R7208:Pdlim2 UTSW 14 70174377 missense probably damaging 1.00
R7597:Pdlim2 UTSW 14 70166196 missense possibly damaging 0.58
R7627:Pdlim2 UTSW 14 70171475 missense probably benign
R8342:Pdlim2 UTSW 14 70166114 missense probably damaging 1.00
R8554:Pdlim2 UTSW 14 70171249 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCAGGCTTTTCTAAGAGGAGG -3'
(R):5'- CGGAGGAATGTCATAAAATGCC -3'

Sequencing Primer
(F):5'- AGGTGCGTCATCTGGGTACAG -3'
(R):5'- ATGCCATTGTGTATAGCTGGATACC -3'
Posted On2019-06-07