Incidental Mutation 'PIT4504001:Zfr'
ID556031
Institutional Source Beutler Lab
Gene Symbol Zfr
Ensembl Gene ENSMUSG00000022201
Gene Namezinc finger RNA binding protein
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4504001 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location12117831-12185683 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12166158 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 838 (E838G)
Ref Sequence ENSEMBL: ENSMUSP00000118911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122941]
Predicted Effect possibly damaging
Transcript: ENSMUST00000122941
AA Change: E838G

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000118911
Gene: ENSMUSG00000022201
AA Change: E838G

DomainStartEndE-ValueType
low complexity region 69 116 N/A INTRINSIC
low complexity region 159 182 N/A INTRINSIC
low complexity region 196 224 N/A INTRINSIC
low complexity region 229 302 N/A INTRINSIC
ZnF_U1 328 362 7.79e-6 SMART
ZnF_C2H2 331 355 4.94e0 SMART
ZnF_U1 379 413 1.84e-7 SMART
ZnF_C2H2 382 406 4.65e-1 SMART
low complexity region 429 448 N/A INTRINSIC
low complexity region 468 483 N/A INTRINSIC
ZnF_U1 579 613 2.01e-8 SMART
ZnF_C2H2 582 606 1.31e0 SMART
low complexity region 630 664 N/A INTRINSIC
low complexity region 685 719 N/A INTRINSIC
low complexity region 766 782 N/A INTRINSIC
DZF 784 1038 5.42e-170 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155054
SMART Domains Protein: ENSMUSP00000114992
Gene: ENSMUSG00000022201

DomainStartEndE-ValueType
low complexity region 19 53 N/A INTRINSIC
PDB:4ATB|D 56 94 6e-11 PDB
low complexity region 100 114 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000119251
Gene: ENSMUSG00000022201
AA Change: E110G

DomainStartEndE-ValueType
low complexity region 34 52 N/A INTRINSIC
DZF 57 299 1.79e-152 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000157034
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.6%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein characterized by its DZF (domain associated with zinc fingers) domain. The encoded protein may play a role in the nucleocytoplasmic shuttling of another RNA-binding protein, Staufen homolog 2, in neurons. Expression of this gene is regulated through alternative polyadenylation that mediates differential microRNA targeting. Elevated expression of this gene has been observed in human patients with pancreatic cancer and knockdown of this gene may result in reduced viability and invasion of pancreatic cancer cells. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired gastrulation, with increased apoptosis and a low mitotic index, and die between embryonic days 8 and 9. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T A 2: 103,717,192 C970* probably null Het
Adgrv1 G A 13: 81,559,352 P1312S probably damaging Het
Als2cr12 T A 1: 58,659,099 I348F probably benign Het
Arid5a T C 1: 36,317,625 I116T probably damaging Het
Bank1 C A 3: 136,100,419 D485Y probably damaging Het
Cbln3 C T 14: 55,883,499 V122M probably damaging Het
Cox10 C T 11: 63,964,216 C413Y possibly damaging Het
Ctsll3 T A 13: 60,801,009 D44V probably benign Het
Cuzd1 A T 7: 131,309,800 N483K possibly damaging Het
Dcaf4 G A 12: 83,534,011 probably null Het
Ddx60 A G 8: 61,958,113 T470A probably benign Het
Dennd1b T C 1: 139,040,004 V44A probably benign Het
Dusp16 C A 6: 134,739,883 V154F possibly damaging Het
Ect2 G A 3: 27,126,948 R586* probably null Het
Ermard T A 17: 15,058,822 C460* probably null Het
Fat2 C T 11: 55,256,110 G4020D possibly damaging Het
Galnt16 G T 12: 80,592,417 E402* probably null Het
Gm5414 T G 15: 101,625,823 D282A probably damaging Het
Gm6741 C T 17: 91,236,916 Q36* probably null Het
Gm7356 A T 17: 14,001,458 L103Q probably damaging Het
Hcn1 A G 13: 117,975,875 T792A possibly damaging Het
Hemgn T C 4: 46,395,863 N458D probably benign Het
Hesx1 C A 14: 27,001,881 D140E probably benign Het
Hfe2 A T 3: 96,528,497 D357V probably damaging Het
Hmgcr A G 13: 96,663,097 I163T possibly damaging Het
Igfbpl1 T C 4: 45,813,469 T249A possibly damaging Het
Il33 A T 19: 29,952,739 H78L probably benign Het
Inpp4b A T 8: 82,041,935 D691V probably damaging Het
Itpr2 T A 6: 146,229,871 N1945I probably damaging Het
Lnpep A G 17: 17,579,027 V122A probably benign Het
Lrp2 T C 2: 69,475,403 D2938G probably damaging Het
Lrrc8c A T 5: 105,608,537 Y726F probably benign Het
Magi3 G T 3: 104,015,526 Q1292K probably benign Het
Mllt3 A C 4: 87,774,087 F546L probably damaging Het
Mrpl14 A G 17: 45,698,221 K82R probably benign Het
Noxred1 A G 12: 87,224,879 V172A possibly damaging Het
Obscn A T 11: 59,133,122 I574N probably damaging Het
Olfr133 A G 17: 38,149,169 T194A probably benign Het
Olfr175-ps1 T A 16: 58,824,308 T134S probably benign Het
Osbpl11 T A 16: 33,234,494 V649D probably benign Het
Pdlim2 G T 14: 70,166,130 P278T probably benign Het
Pm20d2 A C 4: 33,183,152 L223V probably damaging Het
Pmpcb G T 5: 21,743,390 R223L probably damaging Het
Pole2 A T 12: 69,209,985 Y255* probably null Het
Rims1 T A 1: 22,397,460 I317L Het
Scnn1g C A 7: 121,742,331 H239N probably benign Het
Spag17 A G 3: 100,103,110 probably null Het
Tenm3 A T 8: 48,293,657 F1038I probably damaging Het
Tshz2 T C 2: 169,886,051 F856L probably damaging Het
Ubtf A G 11: 102,306,682 S715P unknown Het
Usp13 A C 3: 32,905,430 S557R probably damaging Het
Usp19 T A 9: 108,492,970 S43T probably benign Het
Vmn2r7 A T 3: 64,715,976 Y308N probably benign Het
Zfp455 A G 13: 67,198,621 D32G probably damaging Het
Zfp512 T A 5: 31,476,881 probably null Het
Other mutations in Zfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Zfr APN 15 12159646 missense probably benign 0.26
IGL01759:Zfr APN 15 12159655 missense probably damaging 0.99
IGL01935:Zfr APN 15 12180712 missense probably benign 0.42
IGL02056:Zfr APN 15 12154447 missense probably damaging 1.00
IGL03009:Zfr APN 15 12162235 missense probably damaging 1.00
IGL03147:Zfr UTSW 15 12140552 nonsense probably null
R0377:Zfr UTSW 15 12160591 missense probably benign 0.02
R0678:Zfr UTSW 15 12184085 missense probably damaging 1.00
R0783:Zfr UTSW 15 12162182 missense probably damaging 1.00
R0787:Zfr UTSW 15 12140548 missense unknown
R1464:Zfr UTSW 15 12146372 missense probably damaging 1.00
R1464:Zfr UTSW 15 12146372 missense probably damaging 1.00
R1538:Zfr UTSW 15 12150243 missense possibly damaging 0.61
R1558:Zfr UTSW 15 12140644 missense unknown
R1619:Zfr UTSW 15 12150387 missense possibly damaging 0.52
R1924:Zfr UTSW 15 12160629 missense possibly damaging 0.74
R2163:Zfr UTSW 15 12162223 missense probably damaging 1.00
R2958:Zfr UTSW 15 12162233 missense probably benign 0.08
R2960:Zfr UTSW 15 12162233 missense probably benign 0.08
R2961:Zfr UTSW 15 12162233 missense probably benign 0.08
R2962:Zfr UTSW 15 12162233 missense probably benign 0.08
R2963:Zfr UTSW 15 12162233 missense probably benign 0.08
R3012:Zfr UTSW 15 12166163 missense probably damaging 1.00
R3054:Zfr UTSW 15 12154507 missense probably damaging 1.00
R3429:Zfr UTSW 15 12152920 missense probably benign 0.00
R3611:Zfr UTSW 15 12159762 critical splice donor site probably null
R3825:Zfr UTSW 15 12166191 missense probably damaging 1.00
R3882:Zfr UTSW 15 12162233 missense probably benign 0.08
R4080:Zfr UTSW 15 12162233 missense probably benign 0.08
R4241:Zfr UTSW 15 12149659 missense probably damaging 1.00
R4366:Zfr UTSW 15 12156330 missense probably damaging 0.99
R4375:Zfr UTSW 15 12118340 critical splice donor site probably null
R4893:Zfr UTSW 15 12136542 missense unknown
R4899:Zfr UTSW 15 12166145 missense probably benign 0.11
R4915:Zfr UTSW 15 12162112 critical splice acceptor site probably null
R5870:Zfr UTSW 15 12160615 missense probably damaging 1.00
R6162:Zfr UTSW 15 12146245 missense unknown
R6163:Zfr UTSW 15 12146245 missense unknown
R6165:Zfr UTSW 15 12146245 missense unknown
R6187:Zfr UTSW 15 12146231 small deletion probably benign
R6251:Zfr UTSW 15 12160591 missense probably benign 0.02
R6903:Zfr UTSW 15 12136455 missense unknown
R6959:Zfr UTSW 15 12150323 missense probably damaging 1.00
R7133:Zfr UTSW 15 12180638 missense probably damaging 1.00
R7167:Zfr UTSW 15 12180929 missense probably benign 0.01
R7212:Zfr UTSW 15 12146223 nonsense probably null
R7373:Zfr UTSW 15 12140559 missense unknown
R7489:Zfr UTSW 15 12152982 missense probably benign 0.24
R7602:Zfr UTSW 15 12159677 missense possibly damaging 0.56
R7623:Zfr UTSW 15 12160528 missense possibly damaging 0.83
R7896:Zfr UTSW 15 12146377 missense probably damaging 1.00
R7979:Zfr UTSW 15 12146377 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGTAATCTGGGTACTCTGGC -3'
(R):5'- AGCATGTTGCCTTCTAGGG -3'

Sequencing Primer
(F):5'- AATCTGGGTACTCTGGCATGTG -3'
(R):5'- CTGAATGCCATCATAAAGGGTAG -3'
Posted On2019-06-07