Incidental Mutation 'PIT4504001:Osbpl11'
ID 556033
Institutional Source Beutler Lab
Gene Symbol Osbpl11
Ensembl Gene ENSMUSG00000022807
Gene Name oxysterol binding protein-like 11
Synonyms ORP-11
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # PIT4504001 (G1)
Quality Score 133.008
Status Not validated
Chromosome 16
Chromosomal Location 33185071-33243312 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 33234494 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 649 (V649D)
Ref Sequence ENSEMBL: ENSMUSP00000039632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039733] [ENSMUST00000232100] [ENSMUST00000232181]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000039733
AA Change: V649D

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000039632
Gene: ENSMUSG00000022807
AA Change: V649D

DomainStartEndE-ValueType
low complexity region 37 59 N/A INTRINSIC
PH 70 168 2.03e-14 SMART
low complexity region 257 268 N/A INTRINSIC
Pfam:Oxysterol_BP 383 749 1.9e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000232100
AA Change: V643D

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000232181
AA Change: V649D

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.6%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Like most members, the encoded protein contains an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T A 2: 103,717,192 C970* probably null Het
Adgrv1 G A 13: 81,559,352 P1312S probably damaging Het
Als2cr12 T A 1: 58,659,099 I348F probably benign Het
Arid5a T C 1: 36,317,625 I116T probably damaging Het
Bank1 C A 3: 136,100,419 D485Y probably damaging Het
Cbln3 C T 14: 55,883,499 V122M probably damaging Het
Cox10 C T 11: 63,964,216 C413Y possibly damaging Het
Ctsll3 T A 13: 60,801,009 D44V probably benign Het
Cuzd1 A T 7: 131,309,800 N483K possibly damaging Het
Dcaf4 G A 12: 83,534,011 probably null Het
Ddx60 A G 8: 61,958,113 T470A probably benign Het
Dennd1b T C 1: 139,040,004 V44A probably benign Het
Dusp16 C A 6: 134,739,883 V154F possibly damaging Het
Ect2 G A 3: 27,126,948 R586* probably null Het
Ermard T A 17: 15,058,822 C460* probably null Het
Fat2 C T 11: 55,256,110 G4020D possibly damaging Het
Galnt16 G T 12: 80,592,417 E402* probably null Het
Gm5414 T G 15: 101,625,823 D282A probably damaging Het
Gm6741 C T 17: 91,236,916 Q36* probably null Het
Gm7356 A T 17: 14,001,458 L103Q probably damaging Het
Hcn1 A G 13: 117,975,875 T792A possibly damaging Het
Hemgn T C 4: 46,395,863 N458D probably benign Het
Hesx1 C A 14: 27,001,881 D140E probably benign Het
Hfe2 A T 3: 96,528,497 D357V probably damaging Het
Hmgcr A G 13: 96,663,097 I163T possibly damaging Het
Igfbpl1 T C 4: 45,813,469 T249A possibly damaging Het
Il33 A T 19: 29,952,739 H78L probably benign Het
Inpp4b A T 8: 82,041,935 D691V probably damaging Het
Itpr2 T A 6: 146,229,871 N1945I probably damaging Het
Lnpep A G 17: 17,579,027 V122A probably benign Het
Lrp2 T C 2: 69,475,403 D2938G probably damaging Het
Lrrc8c A T 5: 105,608,537 Y726F probably benign Het
Magi3 G T 3: 104,015,526 Q1292K probably benign Het
Mllt3 A C 4: 87,774,087 F546L probably damaging Het
Mrpl14 A G 17: 45,698,221 K82R probably benign Het
Noxred1 A G 12: 87,224,879 V172A possibly damaging Het
Obscn A T 11: 59,133,122 I574N probably damaging Het
Olfr133 A G 17: 38,149,169 T194A probably benign Het
Olfr175-ps1 T A 16: 58,824,308 T134S probably benign Het
Pdlim2 G T 14: 70,166,130 P278T probably benign Het
Pm20d2 A C 4: 33,183,152 L223V probably damaging Het
Pmpcb G T 5: 21,743,390 R223L probably damaging Het
Pole2 A T 12: 69,209,985 Y255* probably null Het
Rims1 T A 1: 22,397,460 I317L Het
Scnn1g C A 7: 121,742,331 H239N probably benign Het
Spag17 A G 3: 100,103,110 probably null Het
Tenm3 A T 8: 48,293,657 F1038I probably damaging Het
Tshz2 T C 2: 169,886,051 F856L probably damaging Het
Ubtf A G 11: 102,306,682 S715P unknown Het
Usp13 A C 3: 32,905,430 S557R probably damaging Het
Usp19 T A 9: 108,492,970 S43T probably benign Het
Vmn2r7 A T 3: 64,715,976 Y308N probably benign Het
Zfp455 A G 13: 67,198,621 D32G probably damaging Het
Zfp512 T A 5: 31,476,881 probably null Het
Zfr A G 15: 12,166,158 E838G possibly damaging Het
Other mutations in Osbpl11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Osbpl11 APN 16 33241745 missense probably damaging 1.00
IGL01084:Osbpl11 APN 16 33226851 splice site probably benign
IGL03009:Osbpl11 APN 16 33241730 splice site probably benign
R0071:Osbpl11 UTSW 16 33214338 splice site probably benign
R0071:Osbpl11 UTSW 16 33214338 splice site probably benign
R0472:Osbpl11 UTSW 16 33234444 nonsense probably null
R0508:Osbpl11 UTSW 16 33196095 missense probably benign
R0609:Osbpl11 UTSW 16 33234444 nonsense probably null
R0715:Osbpl11 UTSW 16 33241730 splice site probably benign
R1148:Osbpl11 UTSW 16 33227212 missense probably damaging 1.00
R1148:Osbpl11 UTSW 16 33227212 missense probably damaging 1.00
R1275:Osbpl11 UTSW 16 33185850 missense probably benign 0.10
R1459:Osbpl11 UTSW 16 33236329 missense probably damaging 1.00
R1464:Osbpl11 UTSW 16 33229085 missense probably damaging 0.97
R1464:Osbpl11 UTSW 16 33229085 missense probably damaging 0.97
R1591:Osbpl11 UTSW 16 33209983 missense probably benign 0.00
R1752:Osbpl11 UTSW 16 33204835 missense probably damaging 1.00
R1883:Osbpl11 UTSW 16 33214353 missense probably benign
R1916:Osbpl11 UTSW 16 33185843 missense probably benign
R1916:Osbpl11 UTSW 16 33210095 missense possibly damaging 0.82
R4369:Osbpl11 UTSW 16 33224648 missense probably damaging 1.00
R4649:Osbpl11 UTSW 16 33196082 missense probably benign 0.12
R4873:Osbpl11 UTSW 16 33234493 missense probably benign 0.00
R4875:Osbpl11 UTSW 16 33234493 missense probably benign 0.00
R6074:Osbpl11 UTSW 16 33209965 missense probably benign 0.28
R6274:Osbpl11 UTSW 16 33227056 missense probably damaging 1.00
R7007:Osbpl11 UTSW 16 33226939 missense possibly damaging 0.81
R7399:Osbpl11 UTSW 16 33236279 missense probably benign
R7698:Osbpl11 UTSW 16 33234447 missense probably benign 0.04
R7814:Osbpl11 UTSW 16 33210061 nonsense probably null
R7934:Osbpl11 UTSW 16 33236382 missense probably damaging 1.00
R8870:Osbpl11 UTSW 16 33214480 missense probably benign 0.00
R8904:Osbpl11 UTSW 16 33227237 missense probably damaging 1.00
R9149:Osbpl11 UTSW 16 33227290 missense
R9328:Osbpl11 UTSW 16 33226875 missense probably damaging 1.00
R9486:Osbpl11 UTSW 16 33185913 missense possibly damaging 0.89
Z1177:Osbpl11 UTSW 16 33227084 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGATGCATCTGAGTGGTTAC -3'
(R):5'- TGTAAAGTGACTTAGTGACATGGC -3'

Sequencing Primer
(F):5'- CATCTGAGTGGTTACCTAGGACTC -3'
(R):5'- TGGCTTAACTAGACTGCAGAGCTC -3'
Posted On 2019-06-07