Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4504001:Olfr175-ps1'

556034

Institutional Source

Beutler Lab

Gene Symbol

Olfr175-ps1

Ensembl Gene

ENSMUSG00000060663

Gene Name

olfactory receptor 175, pseudogene 1

Synonyms

GA_x54KRFPKG5P-55026345-55025418, GA_x54KRFPKG5P-54993816-54992890, MOR184-1, Olfr174, MOR184-10P

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.105) question?

Stock #

PIT4504001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

58823662-58826782 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 58824308 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 134 (T134S)

Ref Sequence

ENSEMBL: ENSMUSP00000078873 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079955] [ENSMUST00000215069]

AlphaFold

A0A140T8K4

Predicted Effect

probably benign
Transcript: ENSMUST00000079955
AA Change: T134S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000078873
Gene: ENSMUSG00000060663
AA Change: T134S

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	307	1.3e-52	PFAM
Pfam:7TM_GPCR_Srsx	35	305	6.8e-6	PFAM
Pfam:7tm_1	41	290	2.5e-18	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000215069
AA Change: T134S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Coding Region Coverage

1x: 92.8%
3x: 90.6%
10x: 84.7%
20x: 71.6%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abtb2	T	A	2: 103,717,192	C970*	probably null	Het
Adgrv1	G	A	13: 81,559,352	P1312S	probably damaging	Het
Als2cr12	T	A	1: 58,659,099	I348F	probably benign	Het
Arid5a	T	C	1: 36,317,625	I116T	probably damaging	Het
Bank1	C	A	3: 136,100,419	D485Y	probably damaging	Het
Cbln3	C	T	14: 55,883,499	V122M	probably damaging	Het
Cox10	C	T	11: 63,964,216	C413Y	possibly damaging	Het
Ctsll3	T	A	13: 60,801,009	D44V	probably benign	Het
Cuzd1	A	T	7: 131,309,800	N483K	possibly damaging	Het
Dcaf4	G	A	12: 83,534,011		probably null	Het
Ddx60	A	G	8: 61,958,113	T470A	probably benign	Het
Dennd1b	T	C	1: 139,040,004	V44A	probably benign	Het
Dusp16	C	A	6: 134,739,883	V154F	possibly damaging	Het
Ect2	G	A	3: 27,126,948	R586*	probably null	Het
Ermard	T	A	17: 15,058,822	C460*	probably null	Het
Fat2	C	T	11: 55,256,110	G4020D	possibly damaging	Het
Galnt16	G	T	12: 80,592,417	E402*	probably null	Het
Gm5414	T	G	15: 101,625,823	D282A	probably damaging	Het
Gm6741	C	T	17: 91,236,916	Q36*	probably null	Het
Gm7356	A	T	17: 14,001,458	L103Q	probably damaging	Het
Hcn1	A	G	13: 117,975,875	T792A	possibly damaging	Het
Hemgn	T	C	4: 46,395,863	N458D	probably benign	Het
Hesx1	C	A	14: 27,001,881	D140E	probably benign	Het
Hfe2	A	T	3: 96,528,497	D357V	probably damaging	Het
Hmgcr	A	G	13: 96,663,097	I163T	possibly damaging	Het
Igfbpl1	T	C	4: 45,813,469	T249A	possibly damaging	Het
Il33	A	T	19: 29,952,739	H78L	probably benign	Het
Inpp4b	A	T	8: 82,041,935	D691V	probably damaging	Het
Itpr2	T	A	6: 146,229,871	N1945I	probably damaging	Het
Lnpep	A	G	17: 17,579,027	V122A	probably benign	Het
Lrp2	T	C	2: 69,475,403	D2938G	probably damaging	Het
Lrrc8c	A	T	5: 105,608,537	Y726F	probably benign	Het
Magi3	G	T	3: 104,015,526	Q1292K	probably benign	Het
Mllt3	A	C	4: 87,774,087	F546L	probably damaging	Het
Mrpl14	A	G	17: 45,698,221	K82R	probably benign	Het
Noxred1	A	G	12: 87,224,879	V172A	possibly damaging	Het
Obscn	A	T	11: 59,133,122	I574N	probably damaging	Het
Olfr133	A	G	17: 38,149,169	T194A	probably benign	Het
Osbpl11	T	A	16: 33,234,494	V649D	probably benign	Het
Pdlim2	G	T	14: 70,166,130	P278T	probably benign	Het
Pm20d2	A	C	4: 33,183,152	L223V	probably damaging	Het
Pmpcb	G	T	5: 21,743,390	R223L	probably damaging	Het
Pole2	A	T	12: 69,209,985	Y255*	probably null	Het
Rims1	T	A	1: 22,397,460	I317L		Het
Scnn1g	C	A	7: 121,742,331	H239N	probably benign	Het
Spag17	A	G	3: 100,103,110		probably null	Het
Tenm3	A	T	8: 48,293,657	F1038I	probably damaging	Het
Tshz2	T	C	2: 169,886,051	F856L	probably damaging	Het
Ubtf	A	G	11: 102,306,682	S715P	unknown	Het
Usp13	A	C	3: 32,905,430	S557R	probably damaging	Het
Usp19	T	A	9: 108,492,970	S43T	probably benign	Het
Vmn2r7	A	T	3: 64,715,976	Y308N	probably benign	Het
Zfp455	A	G	13: 67,198,621	D32G	probably damaging	Het
Zfp512	T	A	5: 31,476,881		probably null	Het
Zfr	A	G	15: 12,166,158	E838G	possibly damaging	Het

Other mutations in Olfr175-ps1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01402:Olfr175-ps1	APN	16	58824595	missense	probably damaging	1.00
IGL01404:Olfr175-ps1	APN	16	58824595	missense	probably damaging	1.00
IGL01867:Olfr175-ps1	APN	16	58823974	missense	probably damaging	1.00
IGL02073:Olfr175-ps1	APN	16	58823806	missense	probably benign
IGL02393:Olfr175-ps1	APN	16	58824046	missense	probably damaging	0.99
IGL02474:Olfr175-ps1	APN	16	58824656	missense	probably benign
IGL02548:Olfr175-ps1	APN	16	58824328	missense	probably benign	0.42
IGL02948:Olfr175-ps1	APN	16	58824088	missense	probably benign	0.00
R0553:Olfr175-ps1	UTSW	16	58824155	missense	probably damaging	0.99
R1191:Olfr175-ps1	UTSW	16	58824559	missense	probably benign
R1201:Olfr175-ps1	UTSW	16	58823863	missense	probably damaging	0.98
R1458:Olfr175-ps1	UTSW	16	58824676	missense	probably null	0.68
R1469:Olfr175-ps1	UTSW	16	58824610	missense	probably benign
R1469:Olfr175-ps1	UTSW	16	58824610	missense	probably benign
R1843:Olfr175-ps1	UTSW	16	58824077	missense	probably damaging	0.99
R2147:Olfr175-ps1	UTSW	16	58824479	missense	probably damaging	0.99
R2421:Olfr175-ps1	UTSW	16	58824346	missense	probably damaging	1.00
R4370:Olfr175-ps1	UTSW	16	58824593	missense	probably benign	0.00
R4621:Olfr175-ps1	UTSW	16	58824106	missense	possibly damaging	0.94
R4622:Olfr175-ps1	UTSW	16	58824106	missense	possibly damaging	0.94
R4623:Olfr175-ps1	UTSW	16	58824106	missense	possibly damaging	0.94
R4711:Olfr175-ps1	UTSW	16	58824706	start codon destroyed	probably null	0.98
R5323:Olfr175-ps1	UTSW	16	58824703	missense	probably benign
R5447:Olfr175-ps1	UTSW	16	58824483	nonsense	probably null
R5457:Olfr175-ps1	UTSW	16	58824433	missense	probably damaging	0.97
R5546:Olfr175-ps1	UTSW	16	58824153	nonsense	probably null
R5623:Olfr175-ps1	UTSW	16	58824343	missense	probably benign	0.02
R5767:Olfr175-ps1	UTSW	16	58823953	missense	probably benign	0.42
R6270:Olfr175-ps1	UTSW	16	58824419	missense	probably damaging	1.00
R6449:Olfr175-ps1	UTSW	16	58824526	missense	probably damaging	1.00
R7356:Olfr175-ps1	UTSW	16	58824355	missense	probably damaging	0.99
R7521:Olfr175-ps1	UTSW	16	58823894	missense	probably benign	0.00
R7638:Olfr175-ps1	UTSW	16	58824595	missense	probably damaging	1.00
R7814:Olfr175-ps1	UTSW	16	58824002	missense	probably damaging	0.98
R9109:Olfr175-ps1	UTSW	16	58824314	missense	probably damaging	1.00
R9276:Olfr175-ps1	UTSW	16	58824371	missense	probably benign	0.09
X0011:Olfr175-ps1	UTSW	16	58824663	missense	probably benign
Z1176:Olfr175-ps1	UTSW	16	58824307	frame shift	probably null
Z1177:Olfr175-ps1	UTSW	16	58824698	missense	possibly damaging	0.47

Predicted Primers

PCR Primer
(F):5'- AGGGTCAACACATGAGAGTCTG -3'
(R):5'- CCCATGTACATCTTTCTGGGCAAC -3'

Sequencing Primer
(F):5'- TCAACACATGAGAGTCTGTATAGG -3'
(R):5'- GCAACCTGGCTCTCATGGATTC -3'

Posted On

2019-06-07