Incidental Mutation 'PIT4504001:Ermard'
ID 556036
Institutional Source Beutler Lab
Gene Symbol Ermard
Ensembl Gene ENSMUSG00000036552
Gene Name ER membrane associated RNA degradation
Synonyms 2210404J11Rik, 2410011O22Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.172) question?
Stock # PIT4504001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 15261813-15310307 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 15279084 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 460 (C460*)
Ref Sequence ENSEMBL: ENSMUSP00000095005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040594] [ENSMUST00000097393] [ENSMUST00000227252] [ENSMUST00000228803]
AlphaFold E9Q048
Predicted Effect probably null
Transcript: ENSMUST00000040594
AA Change: C12*
SMART Domains Protein: ENSMUSP00000043677
Gene: ENSMUSG00000036552
AA Change: C12*

DomainStartEndE-ValueType
transmembrane domain 130 152 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000097393
AA Change: C460*
SMART Domains Protein: ENSMUSP00000095005
Gene: ENSMUSG00000036552
AA Change: C460*

DomainStartEndE-ValueType
Pfam:DUF4209 133 214 3.1e-27 PFAM
low complexity region 390 399 N/A INTRINSIC
SCOP:g1pnb.1 429 478 4e-3 SMART
low complexity region 583 599 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227252
Predicted Effect probably null
Transcript: ENSMUST00000228803
AA Change: C49*
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.6%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains 2 transmembrane domains near the C-terminus and is localized in the endoplasmic reticulum. Knockout of this gene in developing rat brain showed that it may be involved in neuronal migration. Mutations in this gene are associated with periventricular nodular heterotopia-6 (PVNH6). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T A 2: 103,547,537 (GRCm39) C970* probably null Het
Adgrv1 G A 13: 81,707,471 (GRCm39) P1312S probably damaging Het
Arid5a T C 1: 36,356,706 (GRCm39) I116T probably damaging Het
Bank1 C A 3: 135,806,180 (GRCm39) D485Y probably damaging Het
Cbln3 C T 14: 56,120,956 (GRCm39) V122M probably damaging Het
Cox10 C T 11: 63,855,042 (GRCm39) C413Y possibly damaging Het
Ctsll3 T A 13: 60,948,823 (GRCm39) D44V probably benign Het
Cuzd1 A T 7: 130,911,529 (GRCm39) N483K possibly damaging Het
Dcaf4 G A 12: 83,580,785 (GRCm39) probably null Het
Ddx60 A G 8: 62,411,147 (GRCm39) T470A probably benign Het
Dennd1b T C 1: 138,967,742 (GRCm39) V44A probably benign Het
Dusp16 C A 6: 134,716,846 (GRCm39) V154F possibly damaging Het
Ect2 G A 3: 27,181,097 (GRCm39) R586* probably null Het
Fat2 C T 11: 55,146,936 (GRCm39) G4020D possibly damaging Het
Flacc1 T A 1: 58,698,258 (GRCm39) I348F probably benign Het
Galnt16 G T 12: 80,639,191 (GRCm39) E402* probably null Het
Gm5414 T G 15: 101,534,258 (GRCm39) D282A probably damaging Het
Gm6741 C T 17: 91,544,344 (GRCm39) Q36* probably null Het
Gm7356 A T 17: 14,221,720 (GRCm39) L103Q probably damaging Het
Hcn1 A G 13: 118,112,411 (GRCm39) T792A possibly damaging Het
Hemgn T C 4: 46,395,863 (GRCm39) N458D probably benign Het
Hesx1 C A 14: 26,723,838 (GRCm39) D140E probably benign Het
Hjv A T 3: 96,435,813 (GRCm39) D357V probably damaging Het
Hmgcr A G 13: 96,799,605 (GRCm39) I163T possibly damaging Het
Igfbpl1 T C 4: 45,813,469 (GRCm39) T249A possibly damaging Het
Il33 A T 19: 29,930,139 (GRCm39) H78L probably benign Het
Inpp4b A T 8: 82,768,564 (GRCm39) D691V probably damaging Het
Itpr2 T A 6: 146,131,369 (GRCm39) N1945I probably damaging Het
Lnpep A G 17: 17,799,289 (GRCm39) V122A probably benign Het
Lrp2 T C 2: 69,305,747 (GRCm39) D2938G probably damaging Het
Lrrc8c A T 5: 105,756,403 (GRCm39) Y726F probably benign Het
Magi3 G T 3: 103,922,842 (GRCm39) Q1292K probably benign Het
Mllt3 A C 4: 87,692,324 (GRCm39) F546L probably damaging Het
Mrpl14 A G 17: 46,009,147 (GRCm39) K82R probably benign Het
Noxred1 A G 12: 87,271,653 (GRCm39) V172A possibly damaging Het
Obscn A T 11: 59,023,948 (GRCm39) I574N probably damaging Het
Or2n1b A G 17: 38,460,060 (GRCm39) T194A probably benign Het
Or5k8 T A 16: 58,644,671 (GRCm39) T134S probably benign Het
Osbpl11 T A 16: 33,054,864 (GRCm39) V649D probably benign Het
Pdlim2 G T 14: 70,403,579 (GRCm39) P278T probably benign Het
Pm20d2 A C 4: 33,183,152 (GRCm39) L223V probably damaging Het
Pmpcb G T 5: 21,948,388 (GRCm39) R223L probably damaging Het
Pole2 A T 12: 69,256,759 (GRCm39) Y255* probably null Het
Rims1 T A 1: 22,467,684 (GRCm39) I317L Het
Scnn1g C A 7: 121,341,554 (GRCm39) H239N probably benign Het
Spag17 A G 3: 100,010,426 (GRCm39) probably null Het
Tenm3 A T 8: 48,746,692 (GRCm39) F1038I probably damaging Het
Tshz2 T C 2: 169,727,971 (GRCm39) F856L probably damaging Het
Ubtf A G 11: 102,197,508 (GRCm39) S715P unknown Het
Usp13 A C 3: 32,959,579 (GRCm39) S557R probably damaging Het
Usp19 T A 9: 108,370,169 (GRCm39) S43T probably benign Het
Vmn2r7 A T 3: 64,623,397 (GRCm39) Y308N probably benign Het
Zfp455 A G 13: 67,346,685 (GRCm39) D32G probably damaging Het
Zfp512 T A 5: 31,634,225 (GRCm39) probably null Het
Zfr A G 15: 12,166,244 (GRCm39) E838G possibly damaging Het
Other mutations in Ermard
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Ermard APN 17 15,208,328 (GRCm39) splice site probably benign
IGL01554:Ermard APN 17 15,271,855 (GRCm39) missense possibly damaging 0.94
IGL01832:Ermard APN 17 15,280,111 (GRCm39) missense probably damaging 0.98
IGL02045:Ermard APN 17 15,271,826 (GRCm39) unclassified probably benign
IGL02332:Ermard APN 17 15,210,807 (GRCm39) critical splice acceptor site probably null
IGL02525:Ermard APN 17 15,279,601 (GRCm39) splice site probably benign
IGL03335:Ermard APN 17 15,279,668 (GRCm39) missense probably damaging 1.00
Angelos UTSW 17 15,280,032 (GRCm39) missense possibly damaging 0.73
Eminence UTSW 17 15,273,467 (GRCm39) splice site probably null
R8203_ermard_787 UTSW 17 15,240,548 (GRCm39) missense possibly damaging 0.73
Rechthand UTSW 17 15,279,596 (GRCm39) splice site probably benign
sanctus UTSW 17 15,273,643 (GRCm39) missense probably benign 0.00
R0211:Ermard UTSW 17 15,242,205 (GRCm39) missense probably damaging 0.99
R0211:Ermard UTSW 17 15,242,205 (GRCm39) missense probably damaging 0.99
R0722:Ermard UTSW 17 15,242,390 (GRCm39) missense probably benign 0.13
R0785:Ermard UTSW 17 15,242,239 (GRCm39) missense probably damaging 1.00
R2019:Ermard UTSW 17 15,273,527 (GRCm39) missense probably damaging 1.00
R3696:Ermard UTSW 17 15,273,638 (GRCm39) missense probably benign 0.01
R3697:Ermard UTSW 17 15,273,638 (GRCm39) missense probably benign 0.01
R4077:Ermard UTSW 17 15,273,638 (GRCm39) missense probably benign 0.04
R4383:Ermard UTSW 17 15,280,128 (GRCm39) missense possibly damaging 0.87
R5424:Ermard UTSW 17 15,280,032 (GRCm39) missense possibly damaging 0.73
R6313:Ermard UTSW 17 15,273,467 (GRCm39) splice site probably null
R7685:Ermard UTSW 17 15,279,724 (GRCm39) missense probably benign 0.00
R7800:Ermard UTSW 17 15,277,065 (GRCm39) missense probably benign 0.01
R7802:Ermard UTSW 17 15,281,423 (GRCm39) missense probably benign
R7895:Ermard UTSW 17 15,283,875 (GRCm39) missense possibly damaging 0.66
R8203:Ermard UTSW 17 15,240,548 (GRCm39) missense possibly damaging 0.73
R8229:Ermard UTSW 17 15,279,596 (GRCm39) splice site probably benign
R8318:Ermard UTSW 17 15,242,334 (GRCm39) missense possibly damaging 0.86
R8369:Ermard UTSW 17 15,273,560 (GRCm39) missense probably damaging 0.99
R9179:Ermard UTSW 17 15,273,495 (GRCm39) missense probably damaging 1.00
R9329:Ermard UTSW 17 15,273,643 (GRCm39) missense probably benign 0.00
R9449:Ermard UTSW 17 15,273,554 (GRCm39) missense possibly damaging 0.95
R9506:Ermard UTSW 17 15,281,368 (GRCm39) missense probably damaging 1.00
R9792:Ermard UTSW 17 15,281,441 (GRCm39) missense probably damaging 1.00
R9793:Ermard UTSW 17 15,281,441 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATGGGAAGTACTTGAGCTTG -3'
(R):5'- GTGTTCAACAGCCAACAAGC -3'

Sequencing Primer
(F):5'- GCCAGATGGTTTGCAAATATGC -3'
(R):5'- AAGCTGGGCCCCGTAGTTC -3'
Posted On 2019-06-07