Incidental Mutation 'PIT4504001:Lnpep'
ID 556037
Institutional Source Beutler Lab
Gene Symbol Lnpep
Ensembl Gene ENSMUSG00000023845
Gene Name leucyl/cystinyl aminopeptidase
Synonyms IRAP, 4732490P18Rik, 2010309L07Rik, gp160, vp165
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # PIT4504001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 17747985-17846303 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 17799289 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 122 (V122A)
Ref Sequence ENSEMBL: ENSMUSP00000036998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041047]
AlphaFold Q8C129
Predicted Effect probably benign
Transcript: ENSMUST00000041047
AA Change: V122A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000036998
Gene: ENSMUSG00000023845
AA Change: V122A

DomainStartEndE-ValueType
low complexity region 60 71 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Peptidase_M1 167 552 9.2e-143 PFAM
Pfam:ERAP1_C 689 1007 1e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231666
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232462
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232515
Meta Mutation Damage Score 0.1630 question?
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.6%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc-dependent aminopeptidase that cleaves vasopressin, oxytocin, lys-bradykinin, met-enkephalin, dynorphin A and other peptide hormones. The protein can be secreted in maternal serum, reside in intracellular vesicles with the insulin-responsive glucose transporter GLUT4, or form a type II integral membrane glycoprotein. The protein catalyzes the final step in the conversion of angiotensinogen to angiotensin IV (AT4) and is also a receptor for AT4. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a somewhat reduced tissue uptake of glucose either basally or after insulin stimulation. Mice homozygous for a different knock-out allele exhibit impaired coordination at 3 months and impaired spatial working memory in a Y maze at 6 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T A 2: 103,547,537 (GRCm39) C970* probably null Het
Adgrv1 G A 13: 81,707,471 (GRCm39) P1312S probably damaging Het
Arid5a T C 1: 36,356,706 (GRCm39) I116T probably damaging Het
Bank1 C A 3: 135,806,180 (GRCm39) D485Y probably damaging Het
Cbln3 C T 14: 56,120,956 (GRCm39) V122M probably damaging Het
Cox10 C T 11: 63,855,042 (GRCm39) C413Y possibly damaging Het
Ctsll3 T A 13: 60,948,823 (GRCm39) D44V probably benign Het
Cuzd1 A T 7: 130,911,529 (GRCm39) N483K possibly damaging Het
Dcaf4 G A 12: 83,580,785 (GRCm39) probably null Het
Ddx60 A G 8: 62,411,147 (GRCm39) T470A probably benign Het
Dennd1b T C 1: 138,967,742 (GRCm39) V44A probably benign Het
Dusp16 C A 6: 134,716,846 (GRCm39) V154F possibly damaging Het
Ect2 G A 3: 27,181,097 (GRCm39) R586* probably null Het
Ermard T A 17: 15,279,084 (GRCm39) C460* probably null Het
Fat2 C T 11: 55,146,936 (GRCm39) G4020D possibly damaging Het
Flacc1 T A 1: 58,698,258 (GRCm39) I348F probably benign Het
Galnt16 G T 12: 80,639,191 (GRCm39) E402* probably null Het
Gm5414 T G 15: 101,534,258 (GRCm39) D282A probably damaging Het
Gm6741 C T 17: 91,544,344 (GRCm39) Q36* probably null Het
Gm7356 A T 17: 14,221,720 (GRCm39) L103Q probably damaging Het
Hcn1 A G 13: 118,112,411 (GRCm39) T792A possibly damaging Het
Hemgn T C 4: 46,395,863 (GRCm39) N458D probably benign Het
Hesx1 C A 14: 26,723,838 (GRCm39) D140E probably benign Het
Hjv A T 3: 96,435,813 (GRCm39) D357V probably damaging Het
Hmgcr A G 13: 96,799,605 (GRCm39) I163T possibly damaging Het
Igfbpl1 T C 4: 45,813,469 (GRCm39) T249A possibly damaging Het
Il33 A T 19: 29,930,139 (GRCm39) H78L probably benign Het
Inpp4b A T 8: 82,768,564 (GRCm39) D691V probably damaging Het
Itpr2 T A 6: 146,131,369 (GRCm39) N1945I probably damaging Het
Lrp2 T C 2: 69,305,747 (GRCm39) D2938G probably damaging Het
Lrrc8c A T 5: 105,756,403 (GRCm39) Y726F probably benign Het
Magi3 G T 3: 103,922,842 (GRCm39) Q1292K probably benign Het
Mllt3 A C 4: 87,692,324 (GRCm39) F546L probably damaging Het
Mrpl14 A G 17: 46,009,147 (GRCm39) K82R probably benign Het
Noxred1 A G 12: 87,271,653 (GRCm39) V172A possibly damaging Het
Obscn A T 11: 59,023,948 (GRCm39) I574N probably damaging Het
Or2n1b A G 17: 38,460,060 (GRCm39) T194A probably benign Het
Or5k8 T A 16: 58,644,671 (GRCm39) T134S probably benign Het
Osbpl11 T A 16: 33,054,864 (GRCm39) V649D probably benign Het
Pdlim2 G T 14: 70,403,579 (GRCm39) P278T probably benign Het
Pm20d2 A C 4: 33,183,152 (GRCm39) L223V probably damaging Het
Pmpcb G T 5: 21,948,388 (GRCm39) R223L probably damaging Het
Pole2 A T 12: 69,256,759 (GRCm39) Y255* probably null Het
Rims1 T A 1: 22,467,684 (GRCm39) I317L Het
Scnn1g C A 7: 121,341,554 (GRCm39) H239N probably benign Het
Spag17 A G 3: 100,010,426 (GRCm39) probably null Het
Tenm3 A T 8: 48,746,692 (GRCm39) F1038I probably damaging Het
Tshz2 T C 2: 169,727,971 (GRCm39) F856L probably damaging Het
Ubtf A G 11: 102,197,508 (GRCm39) S715P unknown Het
Usp13 A C 3: 32,959,579 (GRCm39) S557R probably damaging Het
Usp19 T A 9: 108,370,169 (GRCm39) S43T probably benign Het
Vmn2r7 A T 3: 64,623,397 (GRCm39) Y308N probably benign Het
Zfp455 A G 13: 67,346,685 (GRCm39) D32G probably damaging Het
Zfp512 T A 5: 31,634,225 (GRCm39) probably null Het
Zfr A G 15: 12,166,244 (GRCm39) E838G possibly damaging Het
Other mutations in Lnpep
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01983:Lnpep APN 17 17,751,440 (GRCm39) missense probably damaging 1.00
IGL02008:Lnpep APN 17 17,791,219 (GRCm39) missense probably benign 0.40
IGL02040:Lnpep APN 17 17,765,167 (GRCm39) missense probably benign 0.13
IGL02392:Lnpep APN 17 17,799,445 (GRCm39) missense possibly damaging 0.48
IGL02417:Lnpep APN 17 17,765,165 (GRCm39) missense possibly damaging 0.57
IGL02659:Lnpep APN 17 17,791,162 (GRCm39) missense possibly damaging 0.83
IGL02697:Lnpep APN 17 17,773,455 (GRCm39) missense probably benign
IGL02947:Lnpep APN 17 17,791,234 (GRCm39) missense probably damaging 1.00
IGL03493:Lnpep APN 17 17,799,433 (GRCm39) missense probably damaging 1.00
I0000:Lnpep UTSW 17 17,799,233 (GRCm39) missense probably damaging 1.00
R0528:Lnpep UTSW 17 17,751,394 (GRCm39) splice site probably benign
R0535:Lnpep UTSW 17 17,791,935 (GRCm39) missense possibly damaging 0.91
R0540:Lnpep UTSW 17 17,758,816 (GRCm39) missense probably damaging 1.00
R0586:Lnpep UTSW 17 17,795,658 (GRCm39) splice site probably benign
R0607:Lnpep UTSW 17 17,758,816 (GRCm39) missense probably damaging 1.00
R1502:Lnpep UTSW 17 17,791,906 (GRCm39) missense probably damaging 1.00
R1570:Lnpep UTSW 17 17,799,418 (GRCm39) missense probably damaging 1.00
R1733:Lnpep UTSW 17 17,773,575 (GRCm39) missense probably benign 0.00
R1826:Lnpep UTSW 17 17,783,098 (GRCm39) missense probably damaging 1.00
R2015:Lnpep UTSW 17 17,799,325 (GRCm39) missense probably damaging 0.99
R2029:Lnpep UTSW 17 17,788,661 (GRCm39) missense probably damaging 1.00
R4593:Lnpep UTSW 17 17,799,289 (GRCm39) missense probably benign 0.00
R4638:Lnpep UTSW 17 17,795,569 (GRCm39) missense probably damaging 1.00
R4741:Lnpep UTSW 17 17,791,920 (GRCm39) missense probably damaging 1.00
R4919:Lnpep UTSW 17 17,799,173 (GRCm39) missense probably damaging 1.00
R5030:Lnpep UTSW 17 17,799,571 (GRCm39) missense probably damaging 1.00
R5111:Lnpep UTSW 17 17,798,872 (GRCm39) missense possibly damaging 0.93
R5203:Lnpep UTSW 17 17,757,325 (GRCm39) missense probably damaging 1.00
R5320:Lnpep UTSW 17 17,766,727 (GRCm39) missense possibly damaging 0.83
R5419:Lnpep UTSW 17 17,786,992 (GRCm39) missense probably damaging 1.00
R5535:Lnpep UTSW 17 17,758,956 (GRCm39) missense probably benign 0.02
R5680:Lnpep UTSW 17 17,799,444 (GRCm39) nonsense probably null
R6134:Lnpep UTSW 17 17,773,454 (GRCm39) missense probably benign
R6142:Lnpep UTSW 17 17,786,943 (GRCm39) critical splice donor site probably null
R6189:Lnpep UTSW 17 17,787,001 (GRCm39) missense possibly damaging 0.46
R6225:Lnpep UTSW 17 17,799,245 (GRCm39) missense possibly damaging 0.66
R6350:Lnpep UTSW 17 17,783,071 (GRCm39) missense probably benign 0.01
R6357:Lnpep UTSW 17 17,773,176 (GRCm39) missense probably benign 0.00
R6765:Lnpep UTSW 17 17,750,758 (GRCm39) missense probably damaging 1.00
R6794:Lnpep UTSW 17 17,751,421 (GRCm39) missense probably damaging 1.00
R7013:Lnpep UTSW 17 17,788,625 (GRCm39) missense probably benign 0.04
R7208:Lnpep UTSW 17 17,773,172 (GRCm39) nonsense probably null
R7268:Lnpep UTSW 17 17,758,803 (GRCm39) missense probably benign
R7564:Lnpep UTSW 17 17,798,854 (GRCm39) missense probably benign 0.22
R7746:Lnpep UTSW 17 17,758,824 (GRCm39) missense probably benign
R7853:Lnpep UTSW 17 17,783,109 (GRCm39) missense probably benign 0.00
R7881:Lnpep UTSW 17 17,787,001 (GRCm39) missense probably benign 0.01
R8015:Lnpep UTSW 17 17,766,761 (GRCm39) missense probably damaging 1.00
R8070:Lnpep UTSW 17 17,758,900 (GRCm39) missense probably damaging 1.00
R8835:Lnpep UTSW 17 17,750,118 (GRCm39) missense possibly damaging 0.81
R8843:Lnpep UTSW 17 17,773,203 (GRCm39) missense probably damaging 1.00
R9136:Lnpep UTSW 17 17,750,090 (GRCm39) missense probably benign 0.26
R9274:Lnpep UTSW 17 17,758,837 (GRCm39) missense probably benign 0.01
R9427:Lnpep UTSW 17 17,795,609 (GRCm39) missense probably benign 0.08
R9789:Lnpep UTSW 17 17,795,596 (GRCm39) missense probably damaging 1.00
X0004:Lnpep UTSW 17 17,765,074 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCTGAATGTCATTGAGGTTAGG -3'
(R):5'- CTTGGTGAGCATGAGATGGAC -3'

Sequencing Primer
(F):5'- TGGATGTAGGCTAAGTTCATAGC -3'
(R):5'- CGAGGATGAAGAGGATTATGAGTCC -3'
Posted On 2019-06-07