Incidental Mutation 'PIT4504001:Lnpep'
ID556037
Institutional Source Beutler Lab
Gene Symbol Lnpep
Ensembl Gene ENSMUSG00000023845
Gene Nameleucyl/cystinyl aminopeptidase
Synonymsgp160, 4732490P18Rik, 2010309L07Rik, IRAP, vp165
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4504001 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location17521410-17625050 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17579027 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 122 (V122A)
Ref Sequence ENSEMBL: ENSMUSP00000036998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041047]
Predicted Effect probably benign
Transcript: ENSMUST00000041047
AA Change: V122A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000036998
Gene: ENSMUSG00000023845
AA Change: V122A

DomainStartEndE-ValueType
low complexity region 60 71 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Peptidase_M1 167 552 9.2e-143 PFAM
Pfam:ERAP1_C 689 1007 1e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231666
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232462
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232515
Meta Mutation Damage Score 0.1630 question?
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.6%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc-dependent aminopeptidase that cleaves vasopressin, oxytocin, lys-bradykinin, met-enkephalin, dynorphin A and other peptide hormones. The protein can be secreted in maternal serum, reside in intracellular vesicles with the insulin-responsive glucose transporter GLUT4, or form a type II integral membrane glycoprotein. The protein catalyzes the final step in the conversion of angiotensinogen to angiotensin IV (AT4) and is also a receptor for AT4. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a somewhat reduced tissue uptake of glucose either basally or after insulin stimulation. Mice homozygous for a different knock-out allele exhibit impaired coordination at 3 months and impaired spatial working memory in a Y maze at 6 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T A 2: 103,717,192 C970* probably null Het
Adgrv1 G A 13: 81,559,352 P1312S probably damaging Het
Als2cr12 T A 1: 58,659,099 I348F probably benign Het
Arid5a T C 1: 36,317,625 I116T probably damaging Het
Bank1 C A 3: 136,100,419 D485Y probably damaging Het
Cbln3 C T 14: 55,883,499 V122M probably damaging Het
Cox10 C T 11: 63,964,216 C413Y possibly damaging Het
Ctsll3 T A 13: 60,801,009 D44V probably benign Het
Cuzd1 A T 7: 131,309,800 N483K possibly damaging Het
Dcaf4 G A 12: 83,534,011 probably null Het
Ddx60 A G 8: 61,958,113 T470A probably benign Het
Dennd1b T C 1: 139,040,004 V44A probably benign Het
Dusp16 C A 6: 134,739,883 V154F possibly damaging Het
Ect2 G A 3: 27,126,948 R586* probably null Het
Ermard T A 17: 15,058,822 C460* probably null Het
Fat2 C T 11: 55,256,110 G4020D possibly damaging Het
Galnt16 G T 12: 80,592,417 E402* probably null Het
Gm5414 T G 15: 101,625,823 D282A probably damaging Het
Gm6741 C T 17: 91,236,916 Q36* probably null Het
Gm7356 A T 17: 14,001,458 L103Q probably damaging Het
Hcn1 A G 13: 117,975,875 T792A possibly damaging Het
Hemgn T C 4: 46,395,863 N458D probably benign Het
Hesx1 C A 14: 27,001,881 D140E probably benign Het
Hfe2 A T 3: 96,528,497 D357V probably damaging Het
Hmgcr A G 13: 96,663,097 I163T possibly damaging Het
Igfbpl1 T C 4: 45,813,469 T249A possibly damaging Het
Il33 A T 19: 29,952,739 H78L probably benign Het
Inpp4b A T 8: 82,041,935 D691V probably damaging Het
Itpr2 T A 6: 146,229,871 N1945I probably damaging Het
Lrp2 T C 2: 69,475,403 D2938G probably damaging Het
Lrrc8c A T 5: 105,608,537 Y726F probably benign Het
Magi3 G T 3: 104,015,526 Q1292K probably benign Het
Mllt3 A C 4: 87,774,087 F546L probably damaging Het
Mrpl14 A G 17: 45,698,221 K82R probably benign Het
Noxred1 A G 12: 87,224,879 V172A possibly damaging Het
Obscn A T 11: 59,133,122 I574N probably damaging Het
Olfr133 A G 17: 38,149,169 T194A probably benign Het
Olfr175-ps1 T A 16: 58,824,308 T134S probably benign Het
Osbpl11 T A 16: 33,234,494 V649D probably benign Het
Pdlim2 G T 14: 70,166,130 P278T probably benign Het
Pm20d2 A C 4: 33,183,152 L223V probably damaging Het
Pmpcb G T 5: 21,743,390 R223L probably damaging Het
Pole2 A T 12: 69,209,985 Y255* probably null Het
Rims1 T A 1: 22,397,460 I317L Het
Scnn1g C A 7: 121,742,331 H239N probably benign Het
Spag17 A G 3: 100,103,110 probably null Het
Tenm3 A T 8: 48,293,657 F1038I probably damaging Het
Tshz2 T C 2: 169,886,051 F856L probably damaging Het
Ubtf A G 11: 102,306,682 S715P unknown Het
Usp13 A C 3: 32,905,430 S557R probably damaging Het
Usp19 T A 9: 108,492,970 S43T probably benign Het
Vmn2r7 A T 3: 64,715,976 Y308N probably benign Het
Zfp455 A G 13: 67,198,621 D32G probably damaging Het
Zfp512 T A 5: 31,476,881 probably null Het
Zfr A G 15: 12,166,158 E838G possibly damaging Het
Other mutations in Lnpep
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01983:Lnpep APN 17 17531178 missense probably damaging 1.00
IGL02008:Lnpep APN 17 17570957 missense probably benign 0.40
IGL02040:Lnpep APN 17 17544905 missense probably benign 0.13
IGL02392:Lnpep APN 17 17579183 missense possibly damaging 0.48
IGL02417:Lnpep APN 17 17544903 missense possibly damaging 0.57
IGL02659:Lnpep APN 17 17570900 missense possibly damaging 0.83
IGL02697:Lnpep APN 17 17553193 missense probably benign
IGL02947:Lnpep APN 17 17570972 missense probably damaging 1.00
IGL03493:Lnpep APN 17 17579171 missense probably damaging 1.00
I0000:Lnpep UTSW 17 17578971 missense probably damaging 1.00
R0528:Lnpep UTSW 17 17531132 splice site probably benign
R0535:Lnpep UTSW 17 17571673 missense possibly damaging 0.91
R0540:Lnpep UTSW 17 17538554 missense probably damaging 1.00
R0586:Lnpep UTSW 17 17575396 splice site probably benign
R0607:Lnpep UTSW 17 17538554 missense probably damaging 1.00
R1502:Lnpep UTSW 17 17571644 missense probably damaging 1.00
R1570:Lnpep UTSW 17 17579156 missense probably damaging 1.00
R1733:Lnpep UTSW 17 17553313 missense probably benign 0.00
R1826:Lnpep UTSW 17 17562836 missense probably damaging 1.00
R2015:Lnpep UTSW 17 17579063 missense probably damaging 0.99
R2029:Lnpep UTSW 17 17568399 missense probably damaging 1.00
R4593:Lnpep UTSW 17 17579027 missense probably benign 0.00
R4638:Lnpep UTSW 17 17575307 missense probably damaging 1.00
R4741:Lnpep UTSW 17 17571658 missense probably damaging 1.00
R4919:Lnpep UTSW 17 17578911 missense probably damaging 1.00
R5030:Lnpep UTSW 17 17579309 missense probably damaging 1.00
R5111:Lnpep UTSW 17 17578610 missense possibly damaging 0.93
R5203:Lnpep UTSW 17 17537063 missense probably damaging 1.00
R5320:Lnpep UTSW 17 17546465 missense possibly damaging 0.83
R5419:Lnpep UTSW 17 17566730 missense probably damaging 1.00
R5535:Lnpep UTSW 17 17538694 missense probably benign 0.02
R5680:Lnpep UTSW 17 17579182 nonsense probably null
R6134:Lnpep UTSW 17 17553192 missense probably benign
R6142:Lnpep UTSW 17 17566681 critical splice donor site probably null
R6189:Lnpep UTSW 17 17566739 missense possibly damaging 0.46
R6225:Lnpep UTSW 17 17578983 missense possibly damaging 0.66
R6350:Lnpep UTSW 17 17562809 missense probably benign 0.01
R6357:Lnpep UTSW 17 17552914 missense probably benign 0.00
R6765:Lnpep UTSW 17 17530496 missense probably damaging 1.00
R6794:Lnpep UTSW 17 17531159 missense probably damaging 1.00
R7013:Lnpep UTSW 17 17568363 missense probably benign 0.04
R7208:Lnpep UTSW 17 17552910 nonsense probably null
R7268:Lnpep UTSW 17 17538541 missense probably benign
R7564:Lnpep UTSW 17 17578592 missense probably benign 0.22
R7746:Lnpep UTSW 17 17538562 missense probably benign
R7853:Lnpep UTSW 17 17562847 missense probably benign 0.00
R7881:Lnpep UTSW 17 17566739 missense probably benign 0.01
R8015:Lnpep UTSW 17 17546499 missense probably damaging 1.00
R8070:Lnpep UTSW 17 17538638 missense probably damaging 1.00
R8835:Lnpep UTSW 17 17529856 missense possibly damaging 0.81
R8843:Lnpep UTSW 17 17552941 missense probably damaging 1.00
X0004:Lnpep UTSW 17 17544812 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCTGAATGTCATTGAGGTTAGG -3'
(R):5'- CTTGGTGAGCATGAGATGGAC -3'

Sequencing Primer
(F):5'- TGGATGTAGGCTAAGTTCATAGC -3'
(R):5'- CGAGGATGAAGAGGATTATGAGTCC -3'
Posted On2019-06-07