Mutagenetix > Incidental Mutations

Incidental Mutation 'PIT4504001:Lnpep'

556037

Institutional Source

Beutler Lab

Gene Symbol

Lnpep

Ensembl Gene

ENSMUSG00000023845

Gene Name

leucyl/cystinyl aminopeptidase

Synonyms

gp160, 4732490P18Rik, 2010309L07Rik, IRAP, vp165

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

PIT4504001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

17521410-17625050 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 17579027 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 122 (V122A)

Ref Sequence

ENSEMBL: ENSMUSP00000036998 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041047]

Predicted Effect

probably benign
Transcript: ENSMUST00000041047
AA Change: V122A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000036998
Gene: ENSMUSG00000023845
AA Change: V122A

Domain	Start	End	E-Value	Type
low complexity region	60	71	N/A	INTRINSIC
transmembrane domain	110	132	N/A	INTRINSIC
Pfam:Peptidase_M1	167	552	9.2e-143	PFAM
Pfam:ERAP1_C	689	1007	1e-60	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231291

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231515

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231666

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232462

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232515

Meta Mutation Damage Score

0.1630

Coding Region Coverage

1x: 92.8%
3x: 90.6%
10x: 84.7%
20x: 71.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc-dependent aminopeptidase that cleaves vasopressin, oxytocin, lys-bradykinin, met-enkephalin, dynorphin A and other peptide hormones. The protein can be secreted in maternal serum, reside in intracellular vesicles with the insulin-responsive glucose transporter GLUT4, or form a type II integral membrane glycoprotein. The protein catalyzes the final step in the conversion of angiotensinogen to angiotensin IV (AT4) and is also a receptor for AT4. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a somewhat reduced tissue uptake of glucose either basally or after insulin stimulation. Mice homozygous for a different knock-out allele exhibit impaired coordination at 3 months and impaired spatial working memory in a Y maze at 6 months of age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abtb2	T	A	2: 103,717,192	C970*	probably null	Het
Adgrv1	G	A	13: 81,559,352	P1312S	probably damaging	Het
Als2cr12	T	A	1: 58,659,099	I348F	probably benign	Het
Arid5a	T	C	1: 36,317,625	I116T	probably damaging	Het
Bank1	C	A	3: 136,100,419	D485Y	probably damaging	Het
Cbln3	C	T	14: 55,883,499	V122M	probably damaging	Het
Cox10	C	T	11: 63,964,216	C413Y	possibly damaging	Het
Ctsll3	T	A	13: 60,801,009	D44V	probably benign	Het
Cuzd1	A	T	7: 131,309,800	N483K	possibly damaging	Het
Dcaf4	G	A	12: 83,534,011		probably null	Het
Ddx60	A	G	8: 61,958,113	T470A	probably benign	Het
Dennd1b	T	C	1: 139,040,004	V44A	probably benign	Het
Dusp16	C	A	6: 134,739,883	V154F	possibly damaging	Het
Ect2	G	A	3: 27,126,948	R586*	probably null	Het
Ermard	T	A	17: 15,058,822	C460*	probably null	Het
Fat2	C	T	11: 55,256,110	G4020D	possibly damaging	Het
Galnt16	G	T	12: 80,592,417	E402*	probably null	Het
Gm5414	T	G	15: 101,625,823	D282A	probably damaging	Het
Gm6741	C	T	17: 91,236,916	Q36*	probably null	Het
Gm7356	A	T	17: 14,001,458	L103Q	probably damaging	Het
Hcn1	A	G	13: 117,975,875	T792A	possibly damaging	Het
Hemgn	T	C	4: 46,395,863	N458D	probably benign	Het
Hesx1	C	A	14: 27,001,881	D140E	probably benign	Het
Hfe2	A	T	3: 96,528,497	D357V	probably damaging	Het
Hmgcr	A	G	13: 96,663,097	I163T	possibly damaging	Het
Igfbpl1	T	C	4: 45,813,469	T249A	possibly damaging	Het
Il33	A	T	19: 29,952,739	H78L	probably benign	Het
Inpp4b	A	T	8: 82,041,935	D691V	probably damaging	Het
Itpr2	T	A	6: 146,229,871	N1945I	probably damaging	Het
Lrp2	T	C	2: 69,475,403	D2938G	probably damaging	Het
Lrrc8c	A	T	5: 105,608,537	Y726F	probably benign	Het
Magi3	G	T	3: 104,015,526	Q1292K	probably benign	Het
Mllt3	A	C	4: 87,774,087	F546L	probably damaging	Het
Mrpl14	A	G	17: 45,698,221	K82R	probably benign	Het
Noxred1	A	G	12: 87,224,879	V172A	possibly damaging	Het
Obscn	A	T	11: 59,133,122	I574N	probably damaging	Het
Olfr133	A	G	17: 38,149,169	T194A	probably benign	Het
Olfr175-ps1	T	A	16: 58,824,308	T134S	probably benign	Het
Osbpl11	T	A	16: 33,234,494	V649D	probably benign	Het
Pdlim2	G	T	14: 70,166,130	P278T	probably benign	Het
Pm20d2	A	C	4: 33,183,152	L223V	probably damaging	Het
Pmpcb	G	T	5: 21,743,390	R223L	probably damaging	Het
Pole2	A	T	12: 69,209,985	Y255*	probably null	Het
Rims1	T	A	1: 22,397,460	I317L		Het
Scnn1g	C	A	7: 121,742,331	H239N	probably benign	Het
Spag17	A	G	3: 100,103,110		probably null	Het
Tenm3	A	T	8: 48,293,657	F1038I	probably damaging	Het
Tshz2	T	C	2: 169,886,051	F856L	probably damaging	Het
Ubtf	A	G	11: 102,306,682	S715P	unknown	Het
Usp13	A	C	3: 32,905,430	S557R	probably damaging	Het
Usp19	T	A	9: 108,492,970	S43T	probably benign	Het
Vmn2r7	A	T	3: 64,715,976	Y308N	probably benign	Het
Zfp455	A	G	13: 67,198,621	D32G	probably damaging	Het
Zfp512	T	A	5: 31,476,881		probably null	Het
Zfr	A	G	15: 12,166,158	E838G	possibly damaging	Het

Other mutations in Lnpep

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01983:Lnpep	APN	17	17531178	missense	probably damaging	1.00
IGL02008:Lnpep	APN	17	17570957	missense	probably benign	0.40
IGL02040:Lnpep	APN	17	17544905	missense	probably benign	0.13
IGL02392:Lnpep	APN	17	17579183	missense	possibly damaging	0.48
IGL02417:Lnpep	APN	17	17544903	missense	possibly damaging	0.57
IGL02659:Lnpep	APN	17	17570900	missense	possibly damaging	0.83
IGL02697:Lnpep	APN	17	17553193	missense	probably benign
IGL02947:Lnpep	APN	17	17570972	missense	probably damaging	1.00
IGL03493:Lnpep	APN	17	17579171	missense	probably damaging	1.00
I0000:Lnpep	UTSW	17	17578971	missense	probably damaging	1.00
R0528:Lnpep	UTSW	17	17531132	splice site	probably benign
R0535:Lnpep	UTSW	17	17571673	missense	possibly damaging	0.91
R0540:Lnpep	UTSW	17	17538554	missense	probably damaging	1.00
R0586:Lnpep	UTSW	17	17575396	splice site	probably benign
R0607:Lnpep	UTSW	17	17538554	missense	probably damaging	1.00
R1502:Lnpep	UTSW	17	17571644	missense	probably damaging	1.00
R1570:Lnpep	UTSW	17	17579156	missense	probably damaging	1.00
R1733:Lnpep	UTSW	17	17553313	missense	probably benign	0.00
R1826:Lnpep	UTSW	17	17562836	missense	probably damaging	1.00
R2015:Lnpep	UTSW	17	17579063	missense	probably damaging	0.99
R2029:Lnpep	UTSW	17	17568399	missense	probably damaging	1.00
R4593:Lnpep	UTSW	17	17579027	missense	probably benign	0.00
R4638:Lnpep	UTSW	17	17575307	missense	probably damaging	1.00
R4741:Lnpep	UTSW	17	17571658	missense	probably damaging	1.00
R4919:Lnpep	UTSW	17	17578911	missense	probably damaging	1.00
R5030:Lnpep	UTSW	17	17579309	missense	probably damaging	1.00
R5111:Lnpep	UTSW	17	17578610	missense	possibly damaging	0.93
R5203:Lnpep	UTSW	17	17537063	missense	probably damaging	1.00
R5320:Lnpep	UTSW	17	17546465	missense	possibly damaging	0.83
R5419:Lnpep	UTSW	17	17566730	missense	probably damaging	1.00
R5535:Lnpep	UTSW	17	17538694	missense	probably benign	0.02
R5680:Lnpep	UTSW	17	17579182	nonsense	probably null
R6134:Lnpep	UTSW	17	17553192	missense	probably benign
R6142:Lnpep	UTSW	17	17566681	critical splice donor site	probably null
R6189:Lnpep	UTSW	17	17566739	missense	possibly damaging	0.46
R6225:Lnpep	UTSW	17	17578983	missense	possibly damaging	0.66
R6350:Lnpep	UTSW	17	17562809	missense	probably benign	0.01
R6357:Lnpep	UTSW	17	17552914	missense	probably benign	0.00
R6765:Lnpep	UTSW	17	17530496	missense	probably damaging	1.00
R6794:Lnpep	UTSW	17	17531159	missense	probably damaging	1.00
R7013:Lnpep	UTSW	17	17568363	missense	probably benign	0.04
R7208:Lnpep	UTSW	17	17552910	nonsense	probably null
R7268:Lnpep	UTSW	17	17538541	missense	probably benign
R7564:Lnpep	UTSW	17	17578592	missense	probably benign	0.22
R7746:Lnpep	UTSW	17	17538562	missense	probably benign
R7853:Lnpep	UTSW	17	17562847	missense	probably benign	0.00
R7881:Lnpep	UTSW	17	17566739	missense	probably benign	0.01
R8015:Lnpep	UTSW	17	17546499	missense	probably damaging	1.00
R8070:Lnpep	UTSW	17	17538638	missense	probably damaging	1.00
R8835:Lnpep	UTSW	17	17529856	missense	possibly damaging	0.81
R8843:Lnpep	UTSW	17	17552941	missense	probably damaging	1.00
X0004:Lnpep	UTSW	17	17544812	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CCCTGAATGTCATTGAGGTTAGG -3'
(R):5'- CTTGGTGAGCATGAGATGGAC -3'

Sequencing Primer
(F):5'- TGGATGTAGGCTAAGTTCATAGC -3'
(R):5'- CGAGGATGAAGAGGATTATGAGTCC -3'

Posted On

2019-06-07