Incidental Mutation 'R0604:Fetub'
ID55604
Institutional Source Beutler Lab
Gene Symbol Fetub
Ensembl Gene ENSMUSG00000022871
Gene Namefetuin beta
Synonyms2310011O17Rik, D17980
MMRRC Submission 038793-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R0604 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location22918334-22939778 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22935660 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 126 (Y126H)
Ref Sequence ENSEMBL: ENSMUSP00000112324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023587] [ENSMUST00000116625] [ENSMUST00000167399] [ENSMUST00000170805] [ENSMUST00000231768] [ENSMUST00000231880] [ENSMUST00000232097]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023587
AA Change: Y206H

PolyPhen 2 Score 0.541 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000023587
Gene: ENSMUSG00000022871
AA Change: Y206H

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CY 28 129 1.05e-2 SMART
CY 153 255 1.77e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000116625
AA Change: Y126H

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112324
Gene: ENSMUSG00000022871
AA Change: Y126H

DomainStartEndE-ValueType
Blast:CY 1 61 4e-33 BLAST
CY 73 175 1.77e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167399
AA Change: Y206H

PolyPhen 2 Score 0.541 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128745
Gene: ENSMUSG00000022871
AA Change: Y206H

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CY 28 129 1.05e-2 SMART
CY 153 255 1.77e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000170805
AA Change: Y206H

PolyPhen 2 Score 0.541 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128989
Gene: ENSMUSG00000022871
AA Change: Y206H

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CY 28 129 1.05e-2 SMART
CY 153 255 1.77e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000231768
AA Change: Y206H

PolyPhen 2 Score 0.541 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000231880
AA Change: Y126H

PolyPhen 2 Score 0.541 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000232097
AA Change: Y206H

PolyPhen 2 Score 0.541 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fetuin family, part of the cystatin superfamily of cysteine protease inhibitors. Fetuins have been implicated in several diverse functions, including osteogenesis and bone resorption, regulation of the insulin and hepatocyte growth factor receptors, and response to systemic inflammation. This protein may be secreted by cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit female infertility due to premature hardening of the zona pellucida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik C A 2: 28,466,091 R60L possibly damaging Het
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Acap1 T C 11: 69,884,625 E302G probably benign Het
Adrb2 G A 18: 62,178,515 T413I possibly damaging Het
Aqr T C 2: 114,130,604 K725R probably benign Het
Braf A G 6: 39,623,697 I662T probably damaging Het
Ccdc178 A G 18: 22,067,443 S435P probably benign Het
Chd9 A G 8: 91,036,542 M2332V possibly damaging Het
Clgn T C 8: 83,424,194 V496A probably benign Het
Dnah17 A C 11: 118,121,471 S193R probably benign Het
Dntt A G 19: 41,053,149 E424G probably benign Het
Fam149a A G 8: 45,345,008 L492P probably damaging Het
Fgfr3 A T 5: 33,732,782 Y96F probably damaging Het
Gm4952 A G 19: 12,624,672 E148G probably benign Het
Gucy2g T A 19: 55,203,087 L977F probably benign Het
Il1r1 T C 1: 40,282,246 V6A probably benign Het
Itsn2 C A 12: 4,658,189 Q832K probably benign Het
Lats1 T A 10: 7,712,661 F1014Y probably damaging Het
Mcc G A 18: 44,473,756 A536V probably damaging Het
Mtrf1 T C 14: 79,415,887 V334A possibly damaging Het
Olfr1179 T C 2: 88,402,383 T184A probably benign Het
Olfr325 T A 11: 58,581,348 M168K probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr50 T A 2: 36,794,107 Y290* probably null Het
Pard6g A G 18: 80,117,208 S179G probably damaging Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Psg27 A T 7: 18,557,072 V402D probably damaging Het
Rttn A G 18: 88,977,758 I222V probably damaging Het
Sp9 T A 2: 73,273,638 S179T probably benign Het
Tbc1d8 T A 1: 39,405,326 H184L probably damaging Het
Vmn1r69 A G 7: 10,580,654 V50A probably benign Het
Vmn2r58 A G 7: 41,860,576 F526L possibly damaging Het
Other mutations in Fetub
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Fetub APN 16 22935696 missense probably benign 0.29
IGL00843:Fetub APN 16 22929629 splice site probably benign
IGL01450:Fetub APN 16 22929236 missense probably benign 0.01
IGL01522:Fetub APN 16 22929641 start codon destroyed probably null 0.10
IGL02222:Fetub APN 16 22932328 missense probably damaging 1.00
IGL02745:Fetub APN 16 22937926 missense probably damaging 0.99
R0062:Fetub UTSW 16 22929086 intron probably benign
R0310:Fetub UTSW 16 22929756 splice site probably benign
R0508:Fetub UTSW 16 22929295 missense probably benign 0.01
R1560:Fetub UTSW 16 22939367 missense probably benign 0.00
R1844:Fetub UTSW 16 22935669 missense possibly damaging 0.94
R1896:Fetub UTSW 16 22932295 missense probably damaging 1.00
R3716:Fetub UTSW 16 22935693 missense probably damaging 1.00
R3717:Fetub UTSW 16 22935693 missense probably damaging 1.00
R4274:Fetub UTSW 16 22935679 missense probably damaging 1.00
R4751:Fetub UTSW 16 22937895 missense probably benign 0.02
R4941:Fetub UTSW 16 22937874 missense probably benign 0.01
R5468:Fetub UTSW 16 22932331 missense probably damaging 1.00
R5470:Fetub UTSW 16 22932331 missense probably damaging 1.00
R5690:Fetub UTSW 16 22932331 missense probably damaging 1.00
R5692:Fetub UTSW 16 22932331 missense probably damaging 1.00
R5781:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6038:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6038:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6039:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6039:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6193:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6195:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6244:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6245:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6273:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6274:Fetub UTSW 16 22932331 missense probably damaging 1.00
R7134:Fetub UTSW 16 22929257 missense possibly damaging 0.54
R7698:Fetub UTSW 16 22939309 missense probably benign 0.31
R7969:Fetub UTSW 16 22929699 missense possibly damaging 0.89
R8437:Fetub UTSW 16 22934235 missense possibly damaging 0.57
R8788:Fetub UTSW 16 22939432 nonsense probably null
R8855:Fetub UTSW 16 22939571 missense possibly damaging 0.61
R8866:Fetub UTSW 16 22939571 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TGTGGGGACTTCAGGAACAGTGAAC -3'
(R):5'- TTGCCCAGTGGTGCTCAAACACAC -3'

Sequencing Primer
(F):5'- TTCAGGAACAGTGAACTTGGGTG -3'
(R):5'- ACTCACCTCAGAGTCAGAGT -3'
Posted On2013-07-11