Incidental Mutation 'PIT4504001:Il33'
ID556041
Institutional Source Beutler Lab
Gene Symbol Il33
Ensembl Gene ENSMUSG00000024810
Gene Nameinterleukin 33
SynonymsNF-HEV, Il-33, Il1f11, 9230117N10Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4504001 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location29925114-29960718 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 29952739 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 78 (H78L)
Ref Sequence ENSEMBL: ENSMUSP00000025724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025724] [ENSMUST00000120388] [ENSMUST00000136850] [ENSMUST00000144528] [ENSMUST00000177518]
Predicted Effect probably benign
Transcript: ENSMUST00000025724
AA Change: H78L

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000025724
Gene: ENSMUSG00000024810
AA Change: H78L

DomainStartEndE-ValueType
Pfam:IL33 5 264 4.6e-146 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120388
AA Change: H78L

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113829
Gene: ENSMUSG00000024810
AA Change: H78L

DomainStartEndE-ValueType
Pfam:IL33 5 264 3.4e-129 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000136850
AA Change: H59L

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000135324
Gene: ENSMUSG00000024810
AA Change: H59L

DomainStartEndE-ValueType
Pfam:IL33 7 83 1.2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144528
SMART Domains Protein: ENSMUSP00000122319
Gene: ENSMUSG00000024810

DomainStartEndE-ValueType
Pfam:IL33 5 66 2.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177518
AA Change: H78L

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000135854
Gene: ENSMUSG00000024810
AA Change: H78L

DomainStartEndE-ValueType
Pfam:IL33 5 228 4.1e-115 PFAM
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.6%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that binds to the IL1RL1/ST2 receptor. The encoded protein is involved in the maturation of Th2 cells and the activation of mast cells, basophils, eosinophils and natural killer cells. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Nullizygous mutations lead to altered Type 2 immunity and increased susceptibility to parasite infection. Homozygotes for a null allele show accelerated ovarian functional decline and early reproductive aging due to impaired migration of ovarian macrophages and failed disposal of atretic follicles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T A 2: 103,717,192 C970* probably null Het
Adgrv1 G A 13: 81,559,352 P1312S probably damaging Het
Als2cr12 T A 1: 58,659,099 I348F probably benign Het
Arid5a T C 1: 36,317,625 I116T probably damaging Het
Bank1 C A 3: 136,100,419 D485Y probably damaging Het
Cbln3 C T 14: 55,883,499 V122M probably damaging Het
Cox10 C T 11: 63,964,216 C413Y possibly damaging Het
Ctsll3 T A 13: 60,801,009 D44V probably benign Het
Cuzd1 A T 7: 131,309,800 N483K possibly damaging Het
Dcaf4 G A 12: 83,534,011 probably null Het
Ddx60 A G 8: 61,958,113 T470A probably benign Het
Dennd1b T C 1: 139,040,004 V44A probably benign Het
Dusp16 C A 6: 134,739,883 V154F possibly damaging Het
Ect2 G A 3: 27,126,948 R586* probably null Het
Ermard T A 17: 15,058,822 C460* probably null Het
Fat2 C T 11: 55,256,110 G4020D possibly damaging Het
Galnt16 G T 12: 80,592,417 E402* probably null Het
Gm5414 T G 15: 101,625,823 D282A probably damaging Het
Gm6741 C T 17: 91,236,916 Q36* probably null Het
Gm7356 A T 17: 14,001,458 L103Q probably damaging Het
Hcn1 A G 13: 117,975,875 T792A possibly damaging Het
Hemgn T C 4: 46,395,863 N458D probably benign Het
Hesx1 C A 14: 27,001,881 D140E probably benign Het
Hfe2 A T 3: 96,528,497 D357V probably damaging Het
Hmgcr A G 13: 96,663,097 I163T possibly damaging Het
Igfbpl1 T C 4: 45,813,469 T249A possibly damaging Het
Inpp4b A T 8: 82,041,935 D691V probably damaging Het
Itpr2 T A 6: 146,229,871 N1945I probably damaging Het
Lnpep A G 17: 17,579,027 V122A probably benign Het
Lrp2 T C 2: 69,475,403 D2938G probably damaging Het
Lrrc8c A T 5: 105,608,537 Y726F probably benign Het
Magi3 G T 3: 104,015,526 Q1292K probably benign Het
Mllt3 A C 4: 87,774,087 F546L probably damaging Het
Mrpl14 A G 17: 45,698,221 K82R probably benign Het
Noxred1 A G 12: 87,224,879 V172A possibly damaging Het
Obscn A T 11: 59,133,122 I574N probably damaging Het
Olfr133 A G 17: 38,149,169 T194A probably benign Het
Olfr175-ps1 T A 16: 58,824,308 T134S probably benign Het
Osbpl11 T A 16: 33,234,494 V649D probably benign Het
Pdlim2 G T 14: 70,166,130 P278T probably benign Het
Pm20d2 A C 4: 33,183,152 L223V probably damaging Het
Pmpcb G T 5: 21,743,390 R223L probably damaging Het
Pole2 A T 12: 69,209,985 Y255* probably null Het
Rims1 T A 1: 22,397,460 I317L Het
Scnn1g C A 7: 121,742,331 H239N probably benign Het
Spag17 A G 3: 100,103,110 probably null Het
Tenm3 A T 8: 48,293,657 F1038I probably damaging Het
Tshz2 T C 2: 169,886,051 F856L probably damaging Het
Ubtf A G 11: 102,306,682 S715P unknown Het
Usp13 A C 3: 32,905,430 S557R probably damaging Het
Usp19 T A 9: 108,492,970 S43T probably benign Het
Vmn2r7 A T 3: 64,715,976 Y308N probably benign Het
Zfp455 A G 13: 67,198,621 D32G probably damaging Het
Zfp512 T A 5: 31,476,881 probably null Het
Zfr A G 15: 12,166,158 E838G possibly damaging Het
Other mutations in Il33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Il33 APN 19 29952756 missense probably benign 0.00
IGL01531:Il33 APN 19 29951981 missense possibly damaging 0.71
IGL01627:Il33 APN 19 29951990 missense possibly damaging 0.95
IGL02535:Il33 APN 19 29952747 missense probably benign 0.04
lacquer UTSW 19 29951990 missense possibly damaging 0.95
R0548:Il33 UTSW 19 29954647 missense probably benign 0.37
R0557:Il33 UTSW 19 29954636 missense probably damaging 0.98
R1511:Il33 UTSW 19 29955215 missense probably damaging 1.00
R1512:Il33 UTSW 19 29951990 missense possibly damaging 0.95
R1993:Il33 UTSW 19 29956904 missense possibly damaging 0.96
R1994:Il33 UTSW 19 29956904 missense possibly damaging 0.96
R2035:Il33 UTSW 19 29954637 missense probably damaging 0.98
R4779:Il33 UTSW 19 29958911 nonsense probably null
R6429:Il33 UTSW 19 29952000 missense probably benign 0.16
R6498:Il33 UTSW 19 29949737 missense probably benign
R6879:Il33 UTSW 19 29958962 missense probably damaging 0.98
R7218:Il33 UTSW 19 29958925 missense probably damaging 0.99
R7571:Il33 UTSW 19 29956941 missense probably damaging 1.00
X0025:Il33 UTSW 19 29954612 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCAAATGGTCTTCACTTTACG -3'
(R):5'- CTGATGAAGACATGCTCCCAAC -3'

Sequencing Primer
(F):5'- ACGTCATTATTAAGGAGGAATTGATC -3'
(R):5'- TTTGGATAACCACTGAACTGGTACCC -3'
Posted On2019-06-07