Incidental Mutation 'PIT4498001:Olfr1167'
ID556047
Institutional Source Beutler Lab
Gene Symbol Olfr1167
Ensembl Gene ENSMUSG00000100899
Gene Nameolfactory receptor 1167
SynonymsMOR174-16, GA_x6K02T2Q125-49641892-49640942
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #PIT4498001 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location88146150-88155193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88149915 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 35 (T35S)
Ref Sequence ENSEMBL: ENSMUSP00000149599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099832] [ENSMUST00000216951]
Predicted Effect probably benign
Transcript: ENSMUST00000099832
AA Change: T35S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000097420
Gene: ENSMUSG00000100899
AA Change: T35S

DomainStartEndE-ValueType
Pfam:7tm_4 33 310 1.3e-47 PFAM
Pfam:7tm_1 43 292 3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216951
AA Change: T35S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 93.2%
  • 3x: 91.0%
  • 10x: 86.1%
  • 20x: 75.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh18a1 T C 19: 40,574,356 N191S probably benign Het
Cacnb2 T A 2: 14,874,819 L84* probably null Het
Cdhr2 C T 13: 54,718,239 T284M possibly damaging Het
D430042O09Rik A G 7: 125,813,596 T371A probably benign Het
Defb45 T C 2: 152,596,474 probably benign Het
Dkk3 C T 7: 112,119,472 V236M probably benign Het
Dscc1 A T 15: 55,082,315 V328D probably benign Het
Epha3 T C 16: 63,552,526 Y938C probably damaging Het
Erc1 A T 6: 119,779,491 F435I possibly damaging Het
Fbxl5 T C 5: 43,750,981 Y626C possibly damaging Het
Fmn2 A G 1: 174,612,604 R1196G probably damaging Het
Gabrr1 C T 4: 33,160,225 S303F probably damaging Het
Ggt1 T C 10: 75,578,855 V169A possibly damaging Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm13084 T C 4: 143,812,836 E29G possibly damaging Het
Gm3182 T A 14: 4,481,832 C9S probably damaging Het
Gpr88 A C 3: 116,252,615 S16A unknown Het
Kalrn A T 16: 34,031,582 M2076K possibly damaging Het
Kcnd3 T C 3: 105,658,709 I402T probably damaging Het
Mink1 A G 11: 70,598,888 D57G probably benign Het
Ncl T C 1: 86,351,440 T584A possibly damaging Het
Nfx1 A T 4: 40,977,244 Q306L probably benign Het
Ogdh A T 11: 6,340,504 D374V probably benign Het
Pak7 T A 2: 136,083,291 H697L probably damaging Het
Pappa T C 4: 65,316,232 C1425R probably damaging Het
Rab3gap2 T A 1: 185,281,685 I1196N probably damaging Het
Ralyl A T 3: 14,107,239 D56V probably damaging Het
Scin C T 12: 40,069,447 probably null Het
Slc25a19 T C 11: 115,623,955 I69V possibly damaging Het
Slc8a1 G T 17: 81,648,840 Y256* probably null Het
Smyd1 T C 6: 71,219,288 H372R probably benign Het
St8sia1 T C 6: 142,914,122 T94A probably damaging Het
Stard9 T A 2: 120,697,435 M1391K possibly damaging Het
Tlr9 G A 9: 106,223,522 R4H probably benign Het
Trim50 A G 5: 135,353,477 D61G probably damaging Het
Ttn G A 2: 76,766,951 P19873S probably damaging Het
Vmn1r228 G T 17: 20,776,510 H249N probably benign Het
Vmn2r108 C T 17: 20,463,017 G642S probably damaging Het
Wdr27 A G 17: 14,934,569 S29P probably benign Het
Zan A G 5: 137,417,036 probably null Het
Other mutations in Olfr1167
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Olfr1167 APN 2 88149260 missense possibly damaging 0.55
IGL01525:Olfr1167 APN 2 88149877 missense probably benign 0.15
IGL02008:Olfr1167 APN 2 88149578 missense probably damaging 1.00
IGL02116:Olfr1167 APN 2 88149288 missense probably benign 0.03
IGL02740:Olfr1167 APN 2 88149257 missense probably damaging 1.00
IGL03493:Olfr1167 APN 2 88149936 missense probably benign 0.02
R1951:Olfr1167 UTSW 2 88149297 missense possibly damaging 0.50
R2060:Olfr1167 UTSW 2 88149143 missense probably damaging 1.00
R4167:Olfr1167 UTSW 2 88149845 missense probably damaging 0.97
R4168:Olfr1167 UTSW 2 88149845 missense probably damaging 0.97
R4244:Olfr1167 UTSW 2 88149288 missense probably benign 0.00
R5363:Olfr1167 UTSW 2 88149802 missense probably damaging 1.00
R5778:Olfr1167 UTSW 2 88149617 missense probably damaging 1.00
R5939:Olfr1167 UTSW 2 88149509 missense probably damaging 1.00
R6502:Olfr1167 UTSW 2 88150016 start codon destroyed probably null 0.37
R7036:Olfr1167 UTSW 2 88149125 missense probably damaging 0.99
R7104:Olfr1167 UTSW 2 88149372 missense possibly damaging 0.65
R7340:Olfr1167 UTSW 2 88149276 missense possibly damaging 0.95
R7481:Olfr1167 UTSW 2 88149761 missense probably benign 0.12
R7615:Olfr1167 UTSW 2 88149518 missense probably benign 0.01
X0050:Olfr1167 UTSW 2 88149696 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGCCATCACTGCTAACATG -3'
(R):5'- ACATGAGTTTCTACTGCTCCAC -3'

Sequencing Primer
(F):5'- CATCACTGCTAACATGAACATTTCTG -3'
(R):5'- GCTCCACTCTCTCCAGTTCCATAAG -3'
Posted On2019-06-07