Incidental Mutation 'PIT4498001:Gabrr1'
ID556055
Institutional Source Beutler Lab
Gene Symbol Gabrr1
Ensembl Gene ENSMUSG00000028280
Gene Namegamma-aminobutyric acid (GABA) C receptor, subunit rho 1
SynonymsGABA-C
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #PIT4498001 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location33132521-33163588 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 33160225 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 303 (S303F)
Ref Sequence ENSEMBL: ENSMUSP00000029947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029947]
Predicted Effect probably damaging
Transcript: ENSMUST00000029947
AA Change: S303F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029947
Gene: ENSMUSG00000028280
AA Change: S303F

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 69 276 4.8e-53 PFAM
Pfam:Neur_chan_memb 283 402 3.1e-33 PFAM
transmembrane domain 453 472 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.2%
  • 3x: 91.0%
  • 10x: 86.1%
  • 20x: 75.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA receptors, which are ligand-gated chloride channels. GABRR1 is a member of the rho subunit family. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a knock-out allele display altered visual processing in the retina. Mice homozygous for a different knock-out allele exhibit alterations of mechanical pain sensitivity, GABA-inhibited spinal cord responses, and olfactory function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh18a1 T C 19: 40,574,356 N191S probably benign Het
Cacnb2 T A 2: 14,874,819 L84* probably null Het
Cdhr2 C T 13: 54,718,239 T284M possibly damaging Het
D430042O09Rik A G 7: 125,813,596 T371A probably benign Het
Defb45 T C 2: 152,596,474 probably benign Het
Dkk3 C T 7: 112,119,472 V236M probably benign Het
Dscc1 A T 15: 55,082,315 V328D probably benign Het
Epha3 T C 16: 63,552,526 Y938C probably damaging Het
Erc1 A T 6: 119,779,491 F435I possibly damaging Het
Fbxl5 T C 5: 43,750,981 Y626C possibly damaging Het
Fmn2 A G 1: 174,612,604 R1196G probably damaging Het
Ggt1 T C 10: 75,578,855 V169A possibly damaging Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm13084 T C 4: 143,812,836 E29G possibly damaging Het
Gm3182 T A 14: 4,481,832 C9S probably damaging Het
Gpr88 A C 3: 116,252,615 S16A unknown Het
Kalrn A T 16: 34,031,582 M2076K possibly damaging Het
Kcnd3 T C 3: 105,658,709 I402T probably damaging Het
Mink1 A G 11: 70,598,888 D57G probably benign Het
Ncl T C 1: 86,351,440 T584A possibly damaging Het
Nfx1 A T 4: 40,977,244 Q306L probably benign Het
Ogdh A T 11: 6,340,504 D374V probably benign Het
Olfr1167 T A 2: 88,149,915 T35S probably benign Het
Pak7 T A 2: 136,083,291 H697L probably damaging Het
Pappa T C 4: 65,316,232 C1425R probably damaging Het
Rab3gap2 T A 1: 185,281,685 I1196N probably damaging Het
Ralyl A T 3: 14,107,239 D56V probably damaging Het
Scin C T 12: 40,069,447 probably null Het
Slc25a19 T C 11: 115,623,955 I69V possibly damaging Het
Slc8a1 G T 17: 81,648,840 Y256* probably null Het
Smyd1 T C 6: 71,219,288 H372R probably benign Het
St8sia1 T C 6: 142,914,122 T94A probably damaging Het
Stard9 T A 2: 120,697,435 M1391K possibly damaging Het
Tlr9 G A 9: 106,223,522 R4H probably benign Het
Trim50 A G 5: 135,353,477 D61G probably damaging Het
Ttn G A 2: 76,766,951 P19873S probably damaging Het
Vmn1r228 G T 17: 20,776,510 H249N probably benign Het
Vmn2r108 C T 17: 20,463,017 G642S probably damaging Het
Wdr27 A G 17: 14,934,569 S29P probably benign Het
Zan A G 5: 137,417,036 probably null Het
Other mutations in Gabrr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01617:Gabrr1 APN 4 33162634 missense probably benign
IGL02052:Gabrr1 APN 4 33152567 missense probably damaging 0.98
IGL02169:Gabrr1 APN 4 33160261 missense probably damaging 1.00
IGL02834:Gabrr1 APN 4 33151426 missense probably damaging 1.00
R0135:Gabrr1 UTSW 4 33160224 missense probably damaging 1.00
R0606:Gabrr1 UTSW 4 33132696 missense probably benign 0.30
R0739:Gabrr1 UTSW 4 33162781 missense probably benign 0.08
R0843:Gabrr1 UTSW 4 33161717 missense possibly damaging 0.93
R1182:Gabrr1 UTSW 4 33132680 missense probably benign
R1628:Gabrr1 UTSW 4 33152432 missense probably damaging 1.00
R1724:Gabrr1 UTSW 4 33161651 missense probably damaging 0.98
R2300:Gabrr1 UTSW 4 33152449 missense probably benign 0.01
R2405:Gabrr1 UTSW 4 33157110 missense probably damaging 1.00
R3424:Gabrr1 UTSW 4 33158058 missense probably damaging 1.00
R3500:Gabrr1 UTSW 4 33158184 splice site probably benign
R4575:Gabrr1 UTSW 4 33158175 missense possibly damaging 0.94
R4923:Gabrr1 UTSW 4 33162820 missense possibly damaging 0.59
R5686:Gabrr1 UTSW 4 33161684 missense probably damaging 0.98
R5941:Gabrr1 UTSW 4 33162676 missense probably benign 0.01
R6122:Gabrr1 UTSW 4 33161695 missense probably damaging 1.00
R6217:Gabrr1 UTSW 4 33149026 splice site probably null
R6232:Gabrr1 UTSW 4 33161632 missense probably benign 0.41
R6489:Gabrr1 UTSW 4 33162855 missense probably benign 0.02
R6793:Gabrr1 UTSW 4 33162712 missense possibly damaging 0.66
R6996:Gabrr1 UTSW 4 33158157 missense probably damaging 0.96
R7396:Gabrr1 UTSW 4 33160207 missense probably damaging 1.00
R7465:Gabrr1 UTSW 4 33146970 missense probably benign
R7597:Gabrr1 UTSW 4 33148964 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TTGTTTTCTGAAGGAGCCAAGCC -3'
(R):5'- GAGCTGTTTGGGTGGACAAC -3'

Sequencing Primer
(F):5'- AAGCCGCTATGTTGCATGCAC -3'
(R):5'- CCTGGACAGATTTACATGTGGCAC -3'
Posted On2019-06-07