Incidental Mutation 'PIT4498001:Nfx1'
ID556056
Institutional Source Beutler Lab
Gene Symbol Nfx1
Ensembl Gene ENSMUSG00000028423
Gene Namenuclear transcription factor, X-box binding 1
Synonyms1300017N15Rik, Tex42, 3000003M19Rik, TEG-42
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.677) question?
Stock #PIT4498001 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location40970906-41025993 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40977244 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 306 (Q306L)
Ref Sequence ENSEMBL: ENSMUSP00000095747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030133] [ENSMUST00000091614] [ENSMUST00000098143]
Predicted Effect probably benign
Transcript: ENSMUST00000030133
AA Change: Q306L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030133
Gene: ENSMUSG00000028423
AA Change: Q306L

DomainStartEndE-ValueType
RING 352 402 3.91e-2 SMART
ZnF_NFX 447 465 1.23e-3 SMART
ZnF_NFX 500 519 6.16e-4 SMART
ZnF_NFX 561 580 2e-3 SMART
ZnF_NFX 626 649 5.45e-5 SMART
ZnF_NFX 688 707 5.25e0 SMART
ZnF_NFX 715 734 2.92e-5 SMART
ZnF_NFX 772 791 5.25e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091614
AA Change: Q306L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000089203
Gene: ENSMUSG00000028423
AA Change: Q306L

DomainStartEndE-ValueType
RING 352 402 3.91e-2 SMART
ZnF_NFX 447 465 1.23e-3 SMART
ZnF_NFX 500 519 6.16e-4 SMART
ZnF_NFX 561 580 2e-3 SMART
ZnF_NFX 626 649 5.45e-5 SMART
ZnF_NFX 688 707 5.25e0 SMART
ZnF_NFX 715 734 2.92e-5 SMART
ZnF_NFX 772 791 5.25e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098143
AA Change: Q306L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095747
Gene: ENSMUSG00000028423
AA Change: Q306L

DomainStartEndE-ValueType
RING 352 402 3.91e-2 SMART
ZnF_NFX 447 465 1.23e-3 SMART
ZnF_NFX 500 519 6.16e-4 SMART
ZnF_NFX 561 580 2e-3 SMART
ZnF_NFX 626 649 5.45e-5 SMART
ZnF_NFX 688 707 5.25e0 SMART
ZnF_NFX 715 734 2.92e-5 SMART
ZnF_NFX 772 791 5.25e0 SMART
ZnF_NFX 826 848 7.7e-5 SMART
ZnF_NFX 857 878 4.23e-2 SMART
coiled coil region 930 956 N/A INTRINSIC
R3H 977 1055 1.38e-22 SMART
low complexity region 1070 1088 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.2%
  • 3x: 91.0%
  • 10x: 86.1%
  • 20x: 75.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MHC class II gene expression is controlled primarily at the transcriptional level by transcription factors that bind to the X and Y boxes, two highly conserved elements in the proximal promoter of MHC class II genes. The protein encoded by this gene is a transcriptional repressor capable of binding to the conserved X box motif of HLA-DRA and other MHC class II genes in vitro. The protein may play a role in regulating the duration of an inflammatory response by limiting the period in which class II MHC molecules are induced by IFN-gamma. Three alternative splice variants, each of which encodes a different isoform, have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh18a1 T C 19: 40,574,356 N191S probably benign Het
Cacnb2 T A 2: 14,874,819 L84* probably null Het
Cdhr2 C T 13: 54,718,239 T284M possibly damaging Het
D430042O09Rik A G 7: 125,813,596 T371A probably benign Het
Defb45 T C 2: 152,596,474 probably benign Het
Dkk3 C T 7: 112,119,472 V236M probably benign Het
Dscc1 A T 15: 55,082,315 V328D probably benign Het
Epha3 T C 16: 63,552,526 Y938C probably damaging Het
Erc1 A T 6: 119,779,491 F435I possibly damaging Het
Fbxl5 T C 5: 43,750,981 Y626C possibly damaging Het
Fmn2 A G 1: 174,612,604 R1196G probably damaging Het
Gabrr1 C T 4: 33,160,225 S303F probably damaging Het
Ggt1 T C 10: 75,578,855 V169A possibly damaging Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm13084 T C 4: 143,812,836 E29G possibly damaging Het
Gm3182 T A 14: 4,481,832 C9S probably damaging Het
Gpr88 A C 3: 116,252,615 S16A unknown Het
Kalrn A T 16: 34,031,582 M2076K possibly damaging Het
Kcnd3 T C 3: 105,658,709 I402T probably damaging Het
Mink1 A G 11: 70,598,888 D57G probably benign Het
Ncl T C 1: 86,351,440 T584A possibly damaging Het
Ogdh A T 11: 6,340,504 D374V probably benign Het
Olfr1167 T A 2: 88,149,915 T35S probably benign Het
Pak7 T A 2: 136,083,291 H697L probably damaging Het
Pappa T C 4: 65,316,232 C1425R probably damaging Het
Rab3gap2 T A 1: 185,281,685 I1196N probably damaging Het
Ralyl A T 3: 14,107,239 D56V probably damaging Het
Scin C T 12: 40,069,447 probably null Het
Slc25a19 T C 11: 115,623,955 I69V possibly damaging Het
Slc8a1 G T 17: 81,648,840 Y256* probably null Het
Smyd1 T C 6: 71,219,288 H372R probably benign Het
St8sia1 T C 6: 142,914,122 T94A probably damaging Het
Stard9 T A 2: 120,697,435 M1391K possibly damaging Het
Tlr9 G A 9: 106,223,522 R4H probably benign Het
Trim50 A G 5: 135,353,477 D61G probably damaging Het
Ttn G A 2: 76,766,951 P19873S probably damaging Het
Vmn1r228 G T 17: 20,776,510 H249N probably benign Het
Vmn2r108 C T 17: 20,463,017 G642S probably damaging Het
Wdr27 A G 17: 14,934,569 S29P probably benign Het
Zan A G 5: 137,417,036 probably null Het
Other mutations in Nfx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:Nfx1 APN 4 40977241 missense probably benign 0.00
IGL01998:Nfx1 APN 4 41004353 missense probably damaging 1.00
IGL02072:Nfx1 APN 4 41016119 missense probably benign
IGL02170:Nfx1 APN 4 41018019 missense probably damaging 1.00
IGL02188:Nfx1 APN 4 40993827 missense probably damaging 1.00
IGL02502:Nfx1 APN 4 40976345 splice site probably benign
IGL02674:Nfx1 APN 4 40999717 critical splice donor site probably null
IGL03007:Nfx1 APN 4 40984962 missense probably benign 0.02
IGL03092:Nfx1 APN 4 41024851 missense probably damaging 1.00
IGL03303:Nfx1 APN 4 41004323 splice site probably benign
K7371:Nfx1 UTSW 4 40976803 missense probably damaging 1.00
R0032:Nfx1 UTSW 4 41015321 missense probably benign 0.00
R0032:Nfx1 UTSW 4 41015321 missense probably benign 0.00
R0069:Nfx1 UTSW 4 40986688 splice site probably benign
R1056:Nfx1 UTSW 4 41003057 missense probably damaging 0.97
R1449:Nfx1 UTSW 4 40976803 missense probably damaging 1.00
R1635:Nfx1 UTSW 4 40977004 missense probably benign
R1636:Nfx1 UTSW 4 41016072 splice site probably null
R1882:Nfx1 UTSW 4 41009240 missense possibly damaging 0.55
R2089:Nfx1 UTSW 4 40977004 missense probably benign
R2091:Nfx1 UTSW 4 40977004 missense probably benign
R2091:Nfx1 UTSW 4 40977004 missense probably benign
R3792:Nfx1 UTSW 4 41004357 nonsense probably null
R3793:Nfx1 UTSW 4 41004357 nonsense probably null
R4668:Nfx1 UTSW 4 40976367 missense possibly damaging 0.50
R4678:Nfx1 UTSW 4 41012070 missense probably benign 0.01
R4894:Nfx1 UTSW 4 40996877 missense probably damaging 1.00
R4972:Nfx1 UTSW 4 40976375 missense probably benign 0.36
R5066:Nfx1 UTSW 4 40991868 missense probably benign
R5389:Nfx1 UTSW 4 40985000 missense probably damaging 1.00
R5429:Nfx1 UTSW 4 41004343 missense probably damaging 1.00
R5643:Nfx1 UTSW 4 40984973 missense probably null 1.00
R5644:Nfx1 UTSW 4 40984973 missense probably null 1.00
R5915:Nfx1 UTSW 4 40977285 missense probably benign 0.02
R6286:Nfx1 UTSW 4 40986728 missense probably damaging 1.00
R6393:Nfx1 UTSW 4 40976851 missense possibly damaging 0.92
R7409:Nfx1 UTSW 4 41021830 missense possibly damaging 0.64
R7523:Nfx1 UTSW 4 41016119 missense probably benign
X0025:Nfx1 UTSW 4 40976422 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TGAGCAGAGAAGATATCCCCAG -3'
(R):5'- TCTGGTTTCTCAATTGTGCAAC -3'

Sequencing Primer
(F):5'- AAAGGCCTCCCTGGGAAGTG -3'
(R):5'- GTTTCTCAATTGTGCAACTGTATTG -3'
Posted On2019-06-07