Incidental Mutation 'PIT4498001:Dkk3'
ID556065
Institutional Source Beutler Lab
Gene Symbol Dkk3
Ensembl Gene ENSMUSG00000030772
Gene Namedickkopf WNT signaling pathway inhibitor 3
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4498001 (G1)
Quality Score106.008
Status Not validated
Chromosome7
Chromosomal Location112116017-112159057 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 112119472 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 236 (V236M)
Ref Sequence ENSEMBL: ENSMUSP00000033036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033036]
Predicted Effect probably benign
Transcript: ENSMUST00000033036
AA Change: V236M

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000033036
Gene: ENSMUSG00000030772
AA Change: V236M

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
coiled coil region 42 84 N/A INTRINSIC
Pfam:Dickkopf_N 146 196 3e-19 PFAM
Coding Region Coverage
  • 1x: 93.2%
  • 3x: 91.0%
  • 10x: 86.1%
  • 20x: 75.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the dickkopf family. The secreted protein contains two cysteine rich regions and is involved in embryonic development through its interactions with the Wnt signaling pathway. The expression of this gene is decreased in a variety of cancer cell lines and it may function as a tumor suppressor gene. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and euthyroid but exhibit hyperactivity, a slight but significant decrease in the frequency of natural killer cells, and significantly increased IgM, hemoglobin, and hematocrit levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh18a1 T C 19: 40,574,356 N191S probably benign Het
Cacnb2 T A 2: 14,874,819 L84* probably null Het
Cdhr2 C T 13: 54,718,239 T284M possibly damaging Het
D430042O09Rik A G 7: 125,813,596 T371A probably benign Het
Defb45 T C 2: 152,596,474 probably benign Het
Dscc1 A T 15: 55,082,315 V328D probably benign Het
Epha3 T C 16: 63,552,526 Y938C probably damaging Het
Erc1 A T 6: 119,779,491 F435I possibly damaging Het
Fbxl5 T C 5: 43,750,981 Y626C possibly damaging Het
Fmn2 A G 1: 174,612,604 R1196G probably damaging Het
Gabrr1 C T 4: 33,160,225 S303F probably damaging Het
Ggt1 T C 10: 75,578,855 V169A possibly damaging Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm13084 T C 4: 143,812,836 E29G possibly damaging Het
Gm3182 T A 14: 4,481,832 C9S probably damaging Het
Gpr88 A C 3: 116,252,615 S16A unknown Het
Kalrn A T 16: 34,031,582 M2076K possibly damaging Het
Kcnd3 T C 3: 105,658,709 I402T probably damaging Het
Mink1 A G 11: 70,598,888 D57G probably benign Het
Ncl T C 1: 86,351,440 T584A possibly damaging Het
Nfx1 A T 4: 40,977,244 Q306L probably benign Het
Ogdh A T 11: 6,340,504 D374V probably benign Het
Olfr1167 T A 2: 88,149,915 T35S probably benign Het
Pak7 T A 2: 136,083,291 H697L probably damaging Het
Pappa T C 4: 65,316,232 C1425R probably damaging Het
Rab3gap2 T A 1: 185,281,685 I1196N probably damaging Het
Ralyl A T 3: 14,107,239 D56V probably damaging Het
Scin C T 12: 40,069,447 probably null Het
Slc25a19 T C 11: 115,623,955 I69V possibly damaging Het
Slc8a1 G T 17: 81,648,840 Y256* probably null Het
Smyd1 T C 6: 71,219,288 H372R probably benign Het
St8sia1 T C 6: 142,914,122 T94A probably damaging Het
Stard9 T A 2: 120,697,435 M1391K possibly damaging Het
Tlr9 G A 9: 106,223,522 R4H probably benign Het
Trim50 A G 5: 135,353,477 D61G probably damaging Het
Ttn G A 2: 76,766,951 P19873S probably damaging Het
Vmn1r228 G T 17: 20,776,510 H249N probably benign Het
Vmn2r108 C T 17: 20,463,017 G642S probably damaging Het
Wdr27 A G 17: 14,934,569 S29P probably benign Het
Zan A G 5: 137,417,036 probably null Het
Other mutations in Dkk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02086:Dkk3 APN 7 112149029 missense probably benign 0.05
IGL02638:Dkk3 APN 7 112149027 missense probably benign 0.35
IGL02934:Dkk3 APN 7 112150747 missense probably damaging 0.99
R0385:Dkk3 UTSW 7 112158223 missense probably damaging 0.99
R0550:Dkk3 UTSW 7 112158245 missense probably damaging 1.00
R4657:Dkk3 UTSW 7 112149046 critical splice acceptor site probably null
R4952:Dkk3 UTSW 7 112118351 missense probably benign 0.01
R5987:Dkk3 UTSW 7 112150658 missense probably benign 0.00
R6221:Dkk3 UTSW 7 112121646 missense probably damaging 1.00
R7680:Dkk3 UTSW 7 112119363 missense probably damaging 0.99
R8282:Dkk3 UTSW 7 112118282 missense probably damaging 1.00
R8430:Dkk3 UTSW 7 112121646 missense probably damaging 1.00
R8838:Dkk3 UTSW 7 112118335 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCACTCCCAGATGATAATTTTGGC -3'
(R):5'- AGAGGGTTTAGCATCTTCAGGC -3'

Sequencing Primer
(F):5'- CCAGATGATAATTTTGGCTGCTC -3'
(R):5'- AGGCAGATTCCTGTAACTGC -3'
Posted On2019-06-07