Incidental Mutation 'R0604:Mcc'
ID55607
Institutional Source Beutler Lab
Gene Symbol Mcc
Ensembl Gene ENSMUSG00000071856
Gene Namemutated in colorectal cancers
SynonymsD18Ertd451e
MMRRC Submission 038793-MU
Accession Numbers

Ncbi RefSeq: NM_001085373.1, NM_001085374.1; MGI:96930

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0604 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location44425060-44812182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 44473756 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 536 (A536V)
Ref Sequence ENSEMBL: ENSMUSP00000087318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089874] [ENSMUST00000164666]
Predicted Effect probably damaging
Transcript: ENSMUST00000089874
AA Change: A536V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087318
Gene: ENSMUSG00000071856
AA Change: A536V

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
EFh 24 52 1.36e-3 SMART
EFh 57 85 7.36e0 SMART
coiled coil region 196 308 N/A INTRINSIC
coiled coil region 395 466 N/A INTRINSIC
low complexity region 488 493 N/A INTRINSIC
low complexity region 512 517 N/A INTRINSIC
low complexity region 523 537 N/A INTRINSIC
Pfam:MCC-bdg_PDZ 577 641 2.6e-32 PFAM
low complexity region 715 731 N/A INTRINSIC
coiled coil region 738 834 N/A INTRINSIC
low complexity region 853 863 N/A INTRINSIC
Pfam:MCC-bdg_PDZ 906 972 1.1e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164666
AA Change: A361V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128032
Gene: ENSMUSG00000071856
AA Change: A361V

DomainStartEndE-ValueType
coiled coil region 21 133 N/A INTRINSIC
Pfam:MCC-bdg_PDZ 233 289 1.2e-14 PFAM
low complexity region 313 318 N/A INTRINSIC
low complexity region 337 342 N/A INTRINSIC
low complexity region 348 362 N/A INTRINSIC
Pfam:MCC-bdg_PDZ 401 467 3.8e-32 PFAM
low complexity region 540 556 N/A INTRINSIC
coiled coil region 563 659 N/A INTRINSIC
low complexity region 678 688 N/A INTRINSIC
Pfam:MCC-bdg_PDZ 730 798 1.3e-27 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype Strain: 3889488; 4335844
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a candidate colorectal tumor suppressor gene that is thought to negatively regulate cell cycle progression. The orthologous gene in the mouse expresses a phosphoprotein associated with the plasma membrane and membrane organelles, and overexpression of the mouse protein inhibits entry into S phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for hypomorphic or null mutations are viable and fertile with no gross abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(29) : Targeted(2) Gene trapped(27)

Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik C A 2: 28,466,091 R60L possibly damaging Het
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Acap1 T C 11: 69,884,625 E302G probably benign Het
Adrb2 G A 18: 62,178,515 T413I possibly damaging Het
Aqr T C 2: 114,130,604 K725R probably benign Het
Braf A G 6: 39,623,697 I662T probably damaging Het
Ccdc178 A G 18: 22,067,443 S435P probably benign Het
Chd9 A G 8: 91,036,542 M2332V possibly damaging Het
Clgn T C 8: 83,424,194 V496A probably benign Het
Dnah17 A C 11: 118,121,471 S193R probably benign Het
Dntt A G 19: 41,053,149 E424G probably benign Het
Fam149a A G 8: 45,345,008 L492P probably damaging Het
Fetub T C 16: 22,935,660 Y126H possibly damaging Het
Fgfr3 A T 5: 33,732,782 Y96F probably damaging Het
Gm4952 A G 19: 12,624,672 E148G probably benign Het
Gucy2g T A 19: 55,203,087 L977F probably benign Het
Il1r1 T C 1: 40,282,246 V6A probably benign Het
Itsn2 C A 12: 4,658,189 Q832K probably benign Het
Lats1 T A 10: 7,712,661 F1014Y probably damaging Het
Mtrf1 T C 14: 79,415,887 V334A possibly damaging Het
Olfr1179 T C 2: 88,402,383 T184A probably benign Het
Olfr325 T A 11: 58,581,348 M168K probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr50 T A 2: 36,794,107 Y290* probably null Het
Pard6g A G 18: 80,117,208 S179G probably damaging Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Psg27 A T 7: 18,557,072 V402D probably damaging Het
Rttn A G 18: 88,977,758 I222V probably damaging Het
Sp9 T A 2: 73,273,638 S179T probably benign Het
Tbc1d8 T A 1: 39,405,326 H184L probably damaging Het
Vmn1r69 A G 7: 10,580,654 V50A probably benign Het
Vmn2r58 A G 7: 41,860,576 F526L possibly damaging Het
Other mutations in Mcc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Mcc APN 18 44449216 missense possibly damaging 0.93
IGL00981:Mcc APN 18 44449349 missense probably damaging 0.99
IGL00985:Mcc APN 18 44491239 missense probably damaging 1.00
IGL01674:Mcc APN 18 44491156 missense probably benign 0.10
IGL01862:Mcc APN 18 44759296 missense probably benign 0.00
IGL01935:Mcc APN 18 44519516 critical splice donor site probably null
IGL02168:Mcc APN 18 44449299 missense probably damaging 0.97
IGL02449:Mcc APN 18 44459958 missense probably benign 0.10
IGL02613:Mcc APN 18 44429954 missense probably damaging 1.00
IGL02709:Mcc APN 18 44445810 missense possibly damaging 0.73
R0009:Mcc UTSW 18 44445933 missense probably damaging 1.00
R0009:Mcc UTSW 18 44445933 missense probably damaging 1.00
R0021:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0022:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0062:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0062:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0063:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0064:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0217:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0218:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0243:Mcc UTSW 18 44759299 missense probably benign
R0373:Mcc UTSW 18 44475222 missense probably benign 0.01
R0564:Mcc UTSW 18 44468507 missense probably damaging 1.00
R0691:Mcc UTSW 18 44445860 missense possibly damaging 0.67
R0965:Mcc UTSW 18 44724526 missense probably benign 0.41
R1015:Mcc UTSW 18 44724669 missense probably benign
R1186:Mcc UTSW 18 44759403 missense probably benign
R1215:Mcc UTSW 18 44468494 missense possibly damaging 0.93
R1878:Mcc UTSW 18 44468400 missense possibly damaging 0.69
R1990:Mcc UTSW 18 44491315 nonsense probably null
R1991:Mcc UTSW 18 44491315 nonsense probably null
R1992:Mcc UTSW 18 44491315 nonsense probably null
R2186:Mcc UTSW 18 44812078 missense possibly damaging 0.71
R2189:Mcc UTSW 18 44534230 missense possibly damaging 0.93
R2258:Mcc UTSW 18 44475136 missense probably damaging 1.00
R2267:Mcc UTSW 18 44519541 missense probably damaging 0.99
R2310:Mcc UTSW 18 44431366 missense probably damaging 1.00
R2343:Mcc UTSW 18 44459797 critical splice donor site probably null
R2377:Mcc UTSW 18 44519549 missense probably damaging 1.00
R3110:Mcc UTSW 18 44449263 missense probably damaging 1.00
R3112:Mcc UTSW 18 44449263 missense probably damaging 1.00
R4135:Mcc UTSW 18 44724640 missense probably benign 0.03
R4404:Mcc UTSW 18 44759298 missense probably benign
R4600:Mcc UTSW 18 44519520 missense probably damaging 1.00
R4606:Mcc UTSW 18 44468421 missense probably damaging 0.96
R4721:Mcc UTSW 18 44519556 missense probably damaging 1.00
R5858:Mcc UTSW 18 44510141 missense probably damaging 0.98
R5997:Mcc UTSW 18 44449321 missense probably damaging 1.00
R6482:Mcc UTSW 18 44445864 missense possibly damaging 0.94
R6502:Mcc UTSW 18 44468390 nonsense probably null
R6502:Mcc UTSW 18 44468391 missense probably damaging 1.00
R6518:Mcc UTSW 18 44661811 start gained probably benign
R6796:Mcc UTSW 18 44724560 missense probably benign
R6846:Mcc UTSW 18 44473640 missense possibly damaging 0.63
R6879:Mcc UTSW 18 44812112 missense unknown
R7147:Mcc UTSW 18 44493513 missense probably damaging 0.99
R7475:Mcc UTSW 18 44476236 missense probably damaging 0.98
R7515:Mcc UTSW 18 44493432 missense probably benign 0.02
R7608:Mcc UTSW 18 44491227 missense possibly damaging 0.83
R8092:Mcc UTSW 18 44759232 missense probably benign 0.00
R8119:Mcc UTSW 18 44468433 missense possibly damaging 0.95
R8162:Mcc UTSW 18 44449441 critical splice acceptor site probably null
R8187:Mcc UTSW 18 44534260 missense possibly damaging 0.53
R8716:Mcc UTSW 18 44449336 missense possibly damaging 0.92
R8744:Mcc UTSW 18 44724572 missense probably benign
X0010:Mcc UTSW 18 44429957 missense possibly damaging 0.94
Z1177:Mcc UTSW 18 44491246 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GGCAGCCATCTATGACCTACTTGAC -3'
(R):5'- ACCCATGAGACTCAGAAGGGTGAC -3'

Sequencing Primer
(F):5'- atgagaaggcaaggcgg -3'
(R):5'- TCAGAAGGGTGACCATCTGC -3'
Posted On2013-07-11