Incidental Mutation 'PIT4498001:Dscc1'
ID556075
Institutional Source Beutler Lab
Gene Symbol Dscc1
Ensembl Gene ENSMUSG00000022422
Gene NameDNA replication and sister chromatid cohesion 1
Synonyms2600005O03Rik, 2010006I05Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #PIT4498001 (G1)
Quality Score168.009
Status Not validated
Chromosome15
Chromosomal Location55076099-55090491 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55082315 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 328 (V328D)
Ref Sequence ENSEMBL: ENSMUSP00000105860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023059] [ENSMUST00000110231]
Predicted Effect probably benign
Transcript: ENSMUST00000023059
AA Change: V265D

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000023059
Gene: ENSMUSG00000022422
AA Change: V265D

DomainStartEndE-ValueType
low complexity region 38 47 N/A INTRINSIC
Pfam:DUF2036 48 364 7.3e-110 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110231
AA Change: V328D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105860
Gene: ENSMUSG00000022422
AA Change: V328D

DomainStartEndE-ValueType
low complexity region 38 47 N/A INTRINSIC
Pfam:DUF2036 49 271 5.9e-62 PFAM
Pfam:DUF2036 284 426 4.3e-38 PFAM
Coding Region Coverage
  • 1x: 93.2%
  • 3x: 91.0%
  • 10x: 86.1%
  • 20x: 75.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CHTF18 (MIM 613201), CHTF8 (MIM 613202), and DSCC1 are components of an alternative replication factor C (RFC) (see MIM 600404) complex that loads PCNA (MIM 176740) onto DNA during S phase of the cell cycle (Merkle et al., 2003 [PubMed 12766176]; Bermudez et al., 2003 [PubMed 12930902]).[supplied by OMIM, Dec 2009]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh18a1 T C 19: 40,574,356 N191S probably benign Het
Cacnb2 T A 2: 14,874,819 L84* probably null Het
Cdhr2 C T 13: 54,718,239 T284M possibly damaging Het
D430042O09Rik A G 7: 125,813,596 T371A probably benign Het
Defb45 T C 2: 152,596,474 probably benign Het
Dkk3 C T 7: 112,119,472 V236M probably benign Het
Epha3 T C 16: 63,552,526 Y938C probably damaging Het
Erc1 A T 6: 119,779,491 F435I possibly damaging Het
Fbxl5 T C 5: 43,750,981 Y626C possibly damaging Het
Fmn2 A G 1: 174,612,604 R1196G probably damaging Het
Gabrr1 C T 4: 33,160,225 S303F probably damaging Het
Ggt1 T C 10: 75,578,855 V169A possibly damaging Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm13084 T C 4: 143,812,836 E29G possibly damaging Het
Gm3182 T A 14: 4,481,832 C9S probably damaging Het
Gpr88 A C 3: 116,252,615 S16A unknown Het
Kalrn A T 16: 34,031,582 M2076K possibly damaging Het
Kcnd3 T C 3: 105,658,709 I402T probably damaging Het
Mink1 A G 11: 70,598,888 D57G probably benign Het
Ncl T C 1: 86,351,440 T584A possibly damaging Het
Nfx1 A T 4: 40,977,244 Q306L probably benign Het
Ogdh A T 11: 6,340,504 D374V probably benign Het
Olfr1167 T A 2: 88,149,915 T35S probably benign Het
Pak7 T A 2: 136,083,291 H697L probably damaging Het
Pappa T C 4: 65,316,232 C1425R probably damaging Het
Rab3gap2 T A 1: 185,281,685 I1196N probably damaging Het
Ralyl A T 3: 14,107,239 D56V probably damaging Het
Scin C T 12: 40,069,447 probably null Het
Slc25a19 T C 11: 115,623,955 I69V possibly damaging Het
Slc8a1 G T 17: 81,648,840 Y256* probably null Het
Smyd1 T C 6: 71,219,288 H372R probably benign Het
St8sia1 T C 6: 142,914,122 T94A probably damaging Het
Stard9 T A 2: 120,697,435 M1391K possibly damaging Het
Tlr9 G A 9: 106,223,522 R4H probably benign Het
Trim50 A G 5: 135,353,477 D61G probably damaging Het
Ttn G A 2: 76,766,951 P19873S probably damaging Het
Vmn1r228 G T 17: 20,776,510 H249N probably benign Het
Vmn2r108 C T 17: 20,463,017 G642S probably damaging Het
Wdr27 A G 17: 14,934,569 S29P probably benign Het
Zan A G 5: 137,417,036 probably null Het
Other mutations in Dscc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01121:Dscc1 APN 15 55082325 splice site probably benign
IGL01879:Dscc1 APN 15 55086816 missense probably benign 0.21
BB001:Dscc1 UTSW 15 55082176 missense probably benign 0.03
BB011:Dscc1 UTSW 15 55082176 missense probably benign 0.03
PIT4812001:Dscc1 UTSW 15 55082261 missense probably damaging 1.00
R0106:Dscc1 UTSW 15 55083570 missense probably benign 0.10
R0106:Dscc1 UTSW 15 55083570 missense probably benign 0.10
R0594:Dscc1 UTSW 15 55089052 missense possibly damaging 0.69
R0616:Dscc1 UTSW 15 55083570 missense probably benign 0.10
R1458:Dscc1 UTSW 15 55086764 missense probably damaging 1.00
R1498:Dscc1 UTSW 15 55080176 splice site probably benign
R1763:Dscc1 UTSW 15 55080176 splice site probably benign
R1763:Dscc1 UTSW 15 55084139 missense probably damaging 0.98
R1985:Dscc1 UTSW 15 55080176 splice site probably benign
R2418:Dscc1 UTSW 15 55083424 nonsense probably null
R2419:Dscc1 UTSW 15 55083424 nonsense probably null
R3955:Dscc1 UTSW 15 55083553 missense probably benign 0.05
R4773:Dscc1 UTSW 15 55080258 missense probably benign 0.01
R5611:Dscc1 UTSW 15 55082173 missense probably benign 0.23
R6484:Dscc1 UTSW 15 55080290 nonsense probably null
R7562:Dscc1 UTSW 15 55084185 missense probably benign 0.15
R7662:Dscc1 UTSW 15 55076165 missense possibly damaging 0.95
R7924:Dscc1 UTSW 15 55082176 missense probably benign 0.03
Z1088:Dscc1 UTSW 15 55080317 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- GTCAGACACCACCTGGAGAATC -3'
(R):5'- CCAATACAGTGGCAGTGAGG -3'

Sequencing Primer
(F):5'- TGGAGAATCCCAGGCACAGC -3'
(R):5'- TTTAGCCCTGCTACAAGGTGAGAAC -3'
Posted On2019-06-07