Incidental Mutation 'R0604:Adrb2'
ID55608
Institutional Source Beutler Lab
Gene Symbol Adrb2
Ensembl Gene ENSMUSG00000045730
Gene Nameadrenergic receptor, beta 2
SynonymsGpcr7, beta 2-AR, Adrb-2, beta 2-adrenoceptor, Badm
MMRRC Submission 038793-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0604 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location62177817-62179959 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 62178515 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 413 (T413I)
Ref Sequence ENSEMBL: ENSMUSP00000062256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053640] [ENSMUST00000067743]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053640
AA Change: T413I

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000062256
Gene: ENSMUSG00000045730
AA Change: T413I

DomainStartEndE-ValueType
Pfam:7tm_4 40 246 4.7e-10 PFAM
Pfam:7TM_GPCR_Srx 41 250 2.2e-8 PFAM
Pfam:7TM_GPCR_Srsx 43 340 1.4e-15 PFAM
Pfam:7tm_1 50 326 9.8e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067743
SMART Domains Protein: ENSMUSP00000065944
Gene: ENSMUSG00000054589

DomainStartEndE-ValueType
low complexity region 53 69 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: This intronless gene belongs to the G-protein-coupled receptor superfamily, which includes transmembrane proteins that play a role in signal transduction across biological membranes resulting in a variety of physiological responses. The encoded protein is a beta-2 adrenergic receptor which is activated by catecholamine ligands such as adrenaline and epinephrine. The protein participates in the classical signaling pathway involving G protein, adenylyl cyclase, cAMP (3'-5'-cyclic adenosine monophosphate) and protein kinase A (PKA). In humans, this gene is implicated in susceptibility to nocturnal asthma, obesity and type 2 diabetes. [provided by RefSeq, Apr 2013]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene exhibit increased bone mass. The primary physiological consequences are seen during exercise stress and result from alterations in vascular tone and energy metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik C A 2: 28,466,091 R60L possibly damaging Het
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Acap1 T C 11: 69,884,625 E302G probably benign Het
Aqr T C 2: 114,130,604 K725R probably benign Het
Braf A G 6: 39,623,697 I662T probably damaging Het
Ccdc178 A G 18: 22,067,443 S435P probably benign Het
Chd9 A G 8: 91,036,542 M2332V possibly damaging Het
Clgn T C 8: 83,424,194 V496A probably benign Het
Dnah17 A C 11: 118,121,471 S193R probably benign Het
Dntt A G 19: 41,053,149 E424G probably benign Het
Fam149a A G 8: 45,345,008 L492P probably damaging Het
Fetub T C 16: 22,935,660 Y126H possibly damaging Het
Fgfr3 A T 5: 33,732,782 Y96F probably damaging Het
Gm4952 A G 19: 12,624,672 E148G probably benign Het
Gucy2g T A 19: 55,203,087 L977F probably benign Het
Il1r1 T C 1: 40,282,246 V6A probably benign Het
Itsn2 C A 12: 4,658,189 Q832K probably benign Het
Lats1 T A 10: 7,712,661 F1014Y probably damaging Het
Mcc G A 18: 44,473,756 A536V probably damaging Het
Mtrf1 T C 14: 79,415,887 V334A possibly damaging Het
Olfr1179 T C 2: 88,402,383 T184A probably benign Het
Olfr325 T A 11: 58,581,348 M168K probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr50 T A 2: 36,794,107 Y290* probably null Het
Pard6g A G 18: 80,117,208 S179G probably damaging Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Psg27 A T 7: 18,557,072 V402D probably damaging Het
Rttn A G 18: 88,977,758 I222V probably damaging Het
Sp9 T A 2: 73,273,638 S179T probably benign Het
Tbc1d8 T A 1: 39,405,326 H184L probably damaging Het
Vmn1r69 A G 7: 10,580,654 V50A probably benign Het
Vmn2r58 A G 7: 41,860,576 F526L possibly damaging Het
Other mutations in Adrb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02336:Adrb2 APN 18 62179007 missense probably benign 0.00
R0843_Adrb2_277 UTSW 18 62179071 missense probably benign 0.03
R1498_Adrb2_090 UTSW 18 62178933 missense probably damaging 1.00
PIT4514001:Adrb2 UTSW 18 62179727 missense probably benign 0.00
R0091:Adrb2 UTSW 18 62179019 missense probably benign
R0420:Adrb2 UTSW 18 62179539 missense possibly damaging 0.76
R0436:Adrb2 UTSW 18 62179553 missense possibly damaging 0.93
R0626:Adrb2 UTSW 18 62179370 missense probably damaging 1.00
R0843:Adrb2 UTSW 18 62179071 missense probably benign 0.03
R0940:Adrb2 UTSW 18 62179691 missense probably benign 0.00
R1498:Adrb2 UTSW 18 62178933 missense probably damaging 1.00
R1517:Adrb2 UTSW 18 62178800 missense probably damaging 1.00
R1603:Adrb2 UTSW 18 62179508 missense probably damaging 1.00
R1944:Adrb2 UTSW 18 62179413 missense probably damaging 1.00
R4367:Adrb2 UTSW 18 62179056 missense probably damaging 1.00
R5143:Adrb2 UTSW 18 62178776 missense probably damaging 1.00
R5468:Adrb2 UTSW 18 62179625 missense probably damaging 1.00
R5644:Adrb2 UTSW 18 62178682 missense probably benign 0.01
R6073:Adrb2 UTSW 18 62179466 missense probably benign 0.01
R6753:Adrb2 UTSW 18 62179553 missense possibly damaging 0.93
R7883:Adrb2 UTSW 18 62179376 missense probably damaging 0.98
R8298:Adrb2 UTSW 18 62178682 missense probably benign 0.01
R8366:Adrb2 UTSW 18 62178704 missense probably benign 0.00
R8420:Adrb2 UTSW 18 62178933 missense probably damaging 1.00
R8427:Adrb2 UTSW 18 62179274 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGTCACAGCAGAAAGGTCCAAGAC -3'
(R):5'- GCTACTCTAGCAATAGCAACGGCAG -3'

Sequencing Primer
(F):5'- cagacagacagacagacagac -3'
(R):5'- CGGCAGAACGGACTACAC -3'
Posted On2013-07-11