Incidental Mutation 'PIT4486001:Abhd16b'
ID556089
Institutional Source Beutler Lab
Gene Symbol Abhd16b
Ensembl Gene ENSMUSG00000055882
Gene Nameabhydrolase domain containing 16B
SynonymsBC050777
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #PIT4486001 (G1)
Quality Score147.008
Status Not validated
Chromosome2
Chromosomal Location181493206-181494980 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 181493959 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 218 (Q218L)
Ref Sequence ENSEMBL: ENSMUSP00000066520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000844] [ENSMUST00000069649] [ENSMUST00000069712] [ENSMUST00000108799] [ENSMUST00000108800] [ENSMUST00000149163] [ENSMUST00000184588] [ENSMUST00000184849]
Predicted Effect probably benign
Transcript: ENSMUST00000000844
SMART Domains Protein: ENSMUSP00000000844
Gene: ENSMUSG00000000827

DomainStartEndE-ValueType
Pfam:TPD52 28 199 6.2e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069649
AA Change: Q218L

PolyPhen 2 Score 0.388 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000066520
Gene: ENSMUSG00000055882
AA Change: Q218L

DomainStartEndE-ValueType
Pfam:Abhydrolase_1 174 339 2.9e-11 PFAM
Pfam:Abhydrolase_5 174 341 2.1e-13 PFAM
Pfam:Hydrolase_4 180 308 5.1e-9 PFAM
low complexity region 345 357 N/A INTRINSIC
low complexity region 435 452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069712
SMART Domains Protein: ENSMUSP00000068888
Gene: ENSMUSG00000000827

DomainStartEndE-ValueType
Pfam:TPD52 27 193 5.8e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108799
SMART Domains Protein: ENSMUSP00000104427
Gene: ENSMUSG00000000827

DomainStartEndE-ValueType
Pfam:TPD52 18 121 1.9e-38 PFAM
Pfam:TPD52 115 220 1.3e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108800
SMART Domains Protein: ENSMUSP00000104428
Gene: ENSMUSG00000000827

DomainStartEndE-ValueType
Pfam:TPD52 27 179 2.9e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149163
SMART Domains Protein: ENSMUSP00000117690
Gene: ENSMUSG00000000827

DomainStartEndE-ValueType
Pfam:TPD52 28 213 5.2e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184588
Predicted Effect probably benign
Transcript: ENSMUST00000184849
SMART Domains Protein: ENSMUSP00000138837
Gene: ENSMUSG00000000827

DomainStartEndE-ValueType
Pfam:TPD52 9 170 2.4e-54 PFAM
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.5%
  • 10x: 84.1%
  • 20x: 70.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T C 5: 145,044,104 S108P probably damaging Het
4930548H24Rik T A 5: 31,487,743 I280K probably damaging Het
4931408C20Rik G A 1: 26,685,329 P257S probably damaging Het
Abhd3 T A 18: 10,645,233 I354F probably benign Het
Abt1 T C 13: 23,423,681 Y51C possibly damaging Het
Actl9 T A 17: 33,434,198 Y411N possibly damaging Het
Ano4 A G 10: 88,993,029 V516A probably damaging Het
Bptf A T 11: 107,054,788 S2542T probably damaging Het
Card11 C T 5: 140,876,408 V1045M probably damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cdh3 A G 8: 106,541,490 K386E possibly damaging Het
Cks1b C A 3: 89,416,314 Q49H probably damaging Het
Clpb A T 7: 101,663,932 D41V probably benign Het
Cyp3a11 A T 5: 145,860,492 M359K probably damaging Het
Cyp3a13 A T 5: 137,909,966 I207N probably benign Het
Dennd4c T A 4: 86,799,464 L566* probably null Het
Dhtkd1 A T 2: 5,899,995 D859E probably benign Het
Efcab6 T C 15: 83,973,313 D295G probably benign Het
Fcgbp A G 7: 28,075,273 T91A possibly damaging Het
Gm11569 GCAGCTGGGCCTGCAGCAGCTGGAAATGCAGCAGCTAGGACGGCAACA GCA 11: 99,798,665 probably benign Het
Gm884 A T 11: 103,618,201 H980Q unknown Het
Gsdma3 A G 11: 98,638,054 K454E unknown Het
Herc1 T A 9: 66,372,389 I193N probably damaging Het
Kdm5b T A 1: 134,628,685 L1370Q probably damaging Het
Map4 T G 9: 110,072,614 V965G probably damaging Het
Mkrn2os T C 6: 115,585,483 D173G probably benign Het
Ndfip2 A G 14: 105,294,866 D232G probably damaging Het
Nipal2 C T 15: 34,584,729 G231D probably damaging Het
Notch3 A T 17: 32,154,763 N490K probably damaging Het
Olfr150 T A 9: 39,737,239 C141* probably null Het
Olfr493 A G 7: 108,346,322 S220P possibly damaging Het
Prkar2a T C 9: 108,733,127 L185S probably damaging Het
Ptpn9 T G 9: 57,061,003 N542K probably damaging Het
Pus10 G A 11: 23,712,326 probably null Het
Pyroxd2 A G 19: 42,740,389 S191P probably benign Het
Rab15 T A 12: 76,801,942 K122* probably null Het
Rara A G 11: 98,973,495 N416S possibly damaging Het
Rims2 T C 15: 39,476,520 V870A possibly damaging Het
Sec16a T C 2: 26,425,773 T293A Het
Slc26a3 G A 12: 31,470,950 D718N probably benign Het
Slc44a5 G A 3: 154,259,022 V520I possibly damaging Het
Tgfb2 A T 1: 186,690,727 Y142N probably benign Het
Tgfbi A T 13: 56,629,794 I364F probably damaging Het
Tmem144 A C 3: 79,826,867 D176E probably benign Het
Tns4 A T 11: 99,071,335 L612Q probably damaging Het
Toe1 A G 4: 116,806,495 L76S probably damaging Het
Trank1 T C 9: 111,390,107 F1971L probably damaging Het
Tsen54 G T 11: 115,822,596 V481F probably damaging Het
Uimc1 A G 13: 55,075,568 L297P probably damaging Het
Wnt8a T C 18: 34,547,583 Y334H probably damaging Het
Zfp281 A G 1: 136,627,003 D573G possibly damaging Het
Other mutations in Abhd16b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01651:Abhd16b APN 2 181494738 unclassified probably benign
IGL02237:Abhd16b APN 2 181493557 missense probably benign 0.00
IGL02457:Abhd16b APN 2 181494334 missense probably benign 0.00
R1760:Abhd16b UTSW 2 181493404 missense probably damaging 1.00
R2077:Abhd16b UTSW 2 181493416 missense probably benign 0.44
R3124:Abhd16b UTSW 2 181494526 missense possibly damaging 0.70
R4779:Abhd16b UTSW 2 181493460 missense possibly damaging 0.59
R5781:Abhd16b UTSW 2 181494154 missense probably damaging 1.00
R6220:Abhd16b UTSW 2 181493785 missense probably damaging 1.00
R6994:Abhd16b UTSW 2 181493668 missense possibly damaging 0.94
R7305:Abhd16b UTSW 2 181493416 missense possibly damaging 0.85
R7850:Abhd16b UTSW 2 181493725 missense not run
R7933:Abhd16b UTSW 2 181493725 missense not run
R8115:Abhd16b UTSW 2 181493734 missense possibly damaging 0.55
R8132:Abhd16b UTSW 2 181493967 missense probably damaging 1.00
R8214:Abhd16b UTSW 2 181494190 missense probably damaging 1.00
X0052:Abhd16b UTSW 2 181494265 missense probably damaging 1.00
X0066:Abhd16b UTSW 2 181493713 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- ACCATGTTCATGGATCGCCG -3'
(R):5'- TCCAACTCTGGGGCATAACC -3'

Sequencing Primer
(F):5'- TCATGGATCGCCGTCAGCATC -3'
(R):5'- ATAACCTTCAGCGCTAGTGG -3'
Posted On2019-06-07