Incidental Mutation 'R0604:Pard6g'
ID55609
Institutional Source Beutler Lab
Gene Symbol Pard6g
Ensembl Gene ENSMUSG00000056214
Gene Namepar-6 family cell polarity regulator gamma
Synonyms2410049N21Rik
MMRRC Submission 038793-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R0604 (G1)
Quality Score182
Status Not validated
Chromosome18
Chromosomal Location80046895-80119640 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80117208 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 179 (S179G)
Ref Sequence ENSEMBL: ENSMUSP00000069182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070219]
Predicted Effect probably damaging
Transcript: ENSMUST00000070219
AA Change: S179G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069182
Gene: ENSMUSG00000056214
AA Change: S179G

DomainStartEndE-ValueType
PB1 18 98 1.16e-16 SMART
PDZ 168 251 8.6e-14 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik C A 2: 28,466,091 R60L possibly damaging Het
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Acap1 T C 11: 69,884,625 E302G probably benign Het
Adrb2 G A 18: 62,178,515 T413I possibly damaging Het
Aqr T C 2: 114,130,604 K725R probably benign Het
Braf A G 6: 39,623,697 I662T probably damaging Het
Ccdc178 A G 18: 22,067,443 S435P probably benign Het
Chd9 A G 8: 91,036,542 M2332V possibly damaging Het
Clgn T C 8: 83,424,194 V496A probably benign Het
Dnah17 A C 11: 118,121,471 S193R probably benign Het
Dntt A G 19: 41,053,149 E424G probably benign Het
Fam149a A G 8: 45,345,008 L492P probably damaging Het
Fetub T C 16: 22,935,660 Y126H possibly damaging Het
Fgfr3 A T 5: 33,732,782 Y96F probably damaging Het
Gm4952 A G 19: 12,624,672 E148G probably benign Het
Gucy2g T A 19: 55,203,087 L977F probably benign Het
Il1r1 T C 1: 40,282,246 V6A probably benign Het
Itsn2 C A 12: 4,658,189 Q832K probably benign Het
Lats1 T A 10: 7,712,661 F1014Y probably damaging Het
Mcc G A 18: 44,473,756 A536V probably damaging Het
Mtrf1 T C 14: 79,415,887 V334A possibly damaging Het
Olfr1179 T C 2: 88,402,383 T184A probably benign Het
Olfr325 T A 11: 58,581,348 M168K probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr50 T A 2: 36,794,107 Y290* probably null Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Psg27 A T 7: 18,557,072 V402D probably damaging Het
Rttn A G 18: 88,977,758 I222V probably damaging Het
Sp9 T A 2: 73,273,638 S179T probably benign Het
Tbc1d8 T A 1: 39,405,326 H184L probably damaging Het
Vmn1r69 A G 7: 10,580,654 V50A probably benign Het
Vmn2r58 A G 7: 41,860,576 F526L possibly damaging Het
Other mutations in Pard6g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Pard6g APN 18 80079822 splice site probably benign
IGL01514:Pard6g APN 18 80117446 missense probably damaging 1.00
IGL01519:Pard6g APN 18 80079856 missense probably benign 0.34
IGL02305:Pard6g APN 18 80117770 missense probably damaging 1.00
IGL03115:Pard6g APN 18 80079853 missense probably damaging 1.00
R0411:Pard6g UTSW 18 80117122 missense probably damaging 1.00
R0938:Pard6g UTSW 18 80080044 nonsense probably null
R1730:Pard6g UTSW 18 80079825 missense probably damaging 0.97
R1783:Pard6g UTSW 18 80079825 missense probably damaging 0.97
R1785:Pard6g UTSW 18 80117308 missense probably damaging 0.96
R1786:Pard6g UTSW 18 80117308 missense probably damaging 0.96
R1851:Pard6g UTSW 18 80117142 missense probably damaging 1.00
R2070:Pard6g UTSW 18 80117725 missense probably benign 0.00
R2132:Pard6g UTSW 18 80117308 missense probably damaging 0.96
R2133:Pard6g UTSW 18 80117308 missense probably damaging 0.96
R3778:Pard6g UTSW 18 80079823 critical splice acceptor site probably null
R5282:Pard6g UTSW 18 80079901 missense probably benign 0.01
R6084:Pard6g UTSW 18 80117205 missense possibly damaging 0.73
R6913:Pard6g UTSW 18 80117319 missense possibly damaging 0.94
R7124:Pard6g UTSW 18 80117125 missense possibly damaging 0.70
R8109:Pard6g UTSW 18 80117443 missense possibly damaging 0.65
R8469:Pard6g UTSW 18 80047132 missense possibly damaging 0.81
R8903:Pard6g UTSW 18 80117196 nonsense probably null
R8915:Pard6g UTSW 18 80117742 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCAGACTTGCGGTGGCAGATG -3'
(R):5'- GCGGACCACATTGTTCCTTTGGTTG -3'

Sequencing Primer
(F):5'- TTCTTGGCATCACAGGGAC -3'
(R):5'- CCGGCTTGACAGTGACAATG -3'
Posted On2013-07-11