Incidental Mutation 'PIT4486001:Cks1b'
ID556091
Institutional Source Beutler Lab
Gene Symbol Cks1b
Ensembl Gene ENSMUSG00000028044
Gene NameCDC28 protein kinase 1b
Synonyms2610005D03Rik, Cks1, 2410005G18Rik
Accession Numbers
Is this an essential gene? Not available question?
Stock #PIT4486001 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location89415472-89418383 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 89416314 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 49 (Q49H)
Ref Sequence ENSEMBL: ENSMUSP00000029679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029679] [ENSMUST00000039110] [ENSMUST00000050398] [ENSMUST00000107417] [ENSMUST00000107422] [ENSMUST00000107426] [ENSMUST00000107429] [ENSMUST00000125036] [ENSMUST00000128238] [ENSMUST00000129308] [ENSMUST00000154791] [ENSMUST00000162701] [ENSMUST00000183484] [ENSMUST00000191485]
Predicted Effect probably damaging
Transcript: ENSMUST00000029679
AA Change: Q49H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029679
Gene: ENSMUSG00000028044
AA Change: Q49H

DomainStartEndE-ValueType
CKS 5 74 4.1e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000039110
SMART Domains Protein: ENSMUSP00000035361
Gene: ENSMUSG00000042626

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
PTB 47 211 2.15e-31 SMART
SH2 372 451 1.71e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000050398
SMART Domains Protein: ENSMUSP00000051366
Gene: ENSMUSG00000042642

DomainStartEndE-ValueType
MoCF_biosynth 19 180 7.52e-24 SMART
Pfam:PAPS_reduct 303 460 5.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107417
SMART Domains Protein: ENSMUSP00000103040
Gene: ENSMUSG00000042626

DomainStartEndE-ValueType
PTB 2 166 2.15e-31 SMART
SH2 327 406 1.71e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107422
AA Change: Q27H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103045
Gene: ENSMUSG00000028044
AA Change: Q27H

DomainStartEndE-ValueType
CKS 1 52 3.88e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107426
SMART Domains Protein: ENSMUSP00000103049
Gene: ENSMUSG00000042642

DomainStartEndE-ValueType
MoCF_biosynth 19 180 7.52e-24 SMART
Pfam:PAPS_reduct 303 460 4.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107429
SMART Domains Protein: ENSMUSP00000103052
Gene: ENSMUSG00000042642

DomainStartEndE-ValueType
MoCF_biosynth 19 174 2.06e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125036
SMART Domains Protein: ENSMUSP00000115509
Gene: ENSMUSG00000042626

DomainStartEndE-ValueType
PTB 1 155 1.5e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128238
SMART Domains Protein: ENSMUSP00000119293
Gene: ENSMUSG00000042626

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
Pfam:PID 52 144 7.7e-19 PFAM
Pfam:PID 134 190 7.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129308
SMART Domains Protein: ENSMUSP00000122252
Gene: ENSMUSG00000042642

DomainStartEndE-ValueType
MoCF_biosynth 19 180 7.52e-24 SMART
Pfam:PAPS_reduct 303 460 4.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154791
SMART Domains Protein: ENSMUSP00000123635
Gene: ENSMUSG00000042626

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
Pfam:PID 52 100 5.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162701
SMART Domains Protein: ENSMUSP00000125654
Gene: ENSMUSG00000042642

DomainStartEndE-ValueType
MoCF_biosynth 19 99 1.11e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183484
SMART Domains Protein: ENSMUSP00000138900
Gene: ENSMUSG00000028044

DomainStartEndE-ValueType
Pfam:CKS 5 36 2.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191485
SMART Domains Protein: ENSMUSP00000140336
Gene: ENSMUSG00000042626

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
PTB 47 211 2.15e-31 SMART
SH2 372 451 1.71e-26 SMART
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.5%
  • 10x: 84.1%
  • 20x: 70.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CKS1B protein binds to the catalytic subunit of the cyclin dependent kinases and is essential for their biological function. The CKS1B mRNA is found to be expressed in different patterns through the cell cycle in HeLa cells, which reflects a specialized role for the encoded protein. At least two transcript variants have been identified for this gene, and it appears that only one of them encodes a protein. [provided by RefSeq, Sep 2008]
PHENOTYPE: Embryos homozygous for a knock-out allele exhibit a reduced body size that persists through adulthood while heterozygous mice are intermediate in size. Mutant mouse embryonic fibroblasts (MEFs) proliferate poorly and senesce earlier than wild-type MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T C 5: 145,044,104 S108P probably damaging Het
4930548H24Rik T A 5: 31,487,743 I280K probably damaging Het
4931408C20Rik G A 1: 26,685,329 P257S probably damaging Het
Abhd16b A T 2: 181,493,959 Q218L probably benign Het
Abhd3 T A 18: 10,645,233 I354F probably benign Het
Abt1 T C 13: 23,423,681 Y51C possibly damaging Het
Actl9 T A 17: 33,434,198 Y411N possibly damaging Het
Ano4 A G 10: 88,993,029 V516A probably damaging Het
Bptf A T 11: 107,054,788 S2542T probably damaging Het
Card11 C T 5: 140,876,408 V1045M probably damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cdh3 A G 8: 106,541,490 K386E possibly damaging Het
Clpb A T 7: 101,663,932 D41V probably benign Het
Cyp3a11 A T 5: 145,860,492 M359K probably damaging Het
Cyp3a13 A T 5: 137,909,966 I207N probably benign Het
Dennd4c T A 4: 86,799,464 L566* probably null Het
Dhtkd1 A T 2: 5,899,995 D859E probably benign Het
Efcab6 T C 15: 83,973,313 D295G probably benign Het
Fcgbp A G 7: 28,075,273 T91A possibly damaging Het
Gm11569 GCAGCTGGGCCTGCAGCAGCTGGAAATGCAGCAGCTAGGACGGCAACA GCA 11: 99,798,665 probably benign Het
Gm884 A T 11: 103,618,201 H980Q unknown Het
Gsdma3 A G 11: 98,638,054 K454E unknown Het
Herc1 T A 9: 66,372,389 I193N probably damaging Het
Kdm5b T A 1: 134,628,685 L1370Q probably damaging Het
Map4 T G 9: 110,072,614 V965G probably damaging Het
Mkrn2os T C 6: 115,585,483 D173G probably benign Het
Ndfip2 A G 14: 105,294,866 D232G probably damaging Het
Nipal2 C T 15: 34,584,729 G231D probably damaging Het
Notch3 A T 17: 32,154,763 N490K probably damaging Het
Olfr150 T A 9: 39,737,239 C141* probably null Het
Olfr493 A G 7: 108,346,322 S220P possibly damaging Het
Prkar2a T C 9: 108,733,127 L185S probably damaging Het
Ptpn9 T G 9: 57,061,003 N542K probably damaging Het
Pus10 G A 11: 23,712,326 probably null Het
Pyroxd2 A G 19: 42,740,389 S191P probably benign Het
Rab15 T A 12: 76,801,942 K122* probably null Het
Rara A G 11: 98,973,495 N416S possibly damaging Het
Rims2 T C 15: 39,476,520 V870A possibly damaging Het
Sec16a T C 2: 26,425,773 T293A Het
Slc26a3 G A 12: 31,470,950 D718N probably benign Het
Slc44a5 G A 3: 154,259,022 V520I possibly damaging Het
Tgfb2 A T 1: 186,690,727 Y142N probably benign Het
Tgfbi A T 13: 56,629,794 I364F probably damaging Het
Tmem144 A C 3: 79,826,867 D176E probably benign Het
Tns4 A T 11: 99,071,335 L612Q probably damaging Het
Toe1 A G 4: 116,806,495 L76S probably damaging Het
Trank1 T C 9: 111,390,107 F1971L probably damaging Het
Tsen54 G T 11: 115,822,596 V481F probably damaging Het
Uimc1 A G 13: 55,075,568 L297P probably damaging Het
Wnt8a T C 18: 34,547,583 Y334H probably damaging Het
Zfp281 A G 1: 136,627,003 D573G possibly damaging Het
Other mutations in Cks1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1164:Cks1b UTSW 3 89415942 unclassified probably benign
R5378:Cks1b UTSW 3 89416301 missense probably damaging 1.00
R7719:Cks1b UTSW 3 89416328 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGACTCTTCACAGCATGCAG -3'
(R):5'- GCTCTCAGTATGTAGGTCAGTG -3'

Sequencing Primer
(F):5'- AACTGTCTTTGCTTATCTGGAAC -3'
(R):5'- CTCAGTATGTAGGTCAGTGTCTGGC -3'
Posted On2019-06-07