Incidental Mutation 'PIT4486001:Toe1'
ID556094
Institutional Source Beutler Lab
Gene Symbol Toe1
Ensembl Gene ENSMUSG00000028688
Gene Nametarget of EGR1, member 1 (nuclear)
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4486001 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location116794310-116807640 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116806495 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 76 (L76S)
Ref Sequence ENSEMBL: ENSMUSP00000030451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030451] [ENSMUST00000045542] [ENSMUST00000102699] [ENSMUST00000106455] [ENSMUST00000106456] [ENSMUST00000106459] [ENSMUST00000130359] [ENSMUST00000145468]
Predicted Effect probably damaging
Transcript: ENSMUST00000030451
AA Change: L76S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030451
Gene: ENSMUSG00000028688
AA Change: L76S

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Pfam:CAF1 39 171 3.1e-46 PFAM
Pfam:CAF1 164 452 9.9e-40 PFAM
Pfam:zf-CCCH 297 322 2.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045542
SMART Domains Protein: ENSMUSP00000041009
Gene: ENSMUSG00000033985

DomainStartEndE-ValueType
low complexity region 24 30 N/A INTRINSIC
Pfam:Pkinase 59 309 1.6e-48 PFAM
Pfam:Pkinase_Tyr 59 309 1.2e-50 PFAM
low complexity region 539 546 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102699
SMART Domains Protein: ENSMUSP00000099760
Gene: ENSMUSG00000028687

DomainStartEndE-ValueType
ENDO3c 107 259 1.46e-52 SMART
FES 260 280 2.16e-5 SMART
Pfam:NUDIX_4 353 463 2.3e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106455
AA Change: L76S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102063
Gene: ENSMUSG00000028688
AA Change: L76S

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Pfam:CAF1 37 301 2.1e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106456
SMART Domains Protein: ENSMUSP00000102064
Gene: ENSMUSG00000033985

DomainStartEndE-ValueType
low complexity region 24 30 N/A INTRINSIC
Pfam:Pkinase_Tyr 59 291 4.5e-46 PFAM
Pfam:Pkinase 60 332 3.6e-46 PFAM
low complexity region 510 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106459
SMART Domains Protein: ENSMUSP00000102067
Gene: ENSMUSG00000033985

DomainStartEndE-ValueType
low complexity region 24 30 N/A INTRINSIC
Pfam:Pkinase_Tyr 59 238 6.1e-37 PFAM
Pfam:Pkinase 60 239 4.3e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130359
Predicted Effect probably damaging
Transcript: ENSMUST00000145468
AA Change: L10S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117019
Gene: ENSMUSG00000028688
AA Change: L10S

DomainStartEndE-ValueType
Pfam:CAF1 1 184 2.2e-58 PFAM
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.5%
  • 10x: 84.1%
  • 20x: 70.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T C 5: 145,044,104 S108P probably damaging Het
4930548H24Rik T A 5: 31,487,743 I280K probably damaging Het
4931408C20Rik G A 1: 26,685,329 P257S probably damaging Het
Abhd16b A T 2: 181,493,959 Q218L probably benign Het
Abhd3 T A 18: 10,645,233 I354F probably benign Het
Abt1 T C 13: 23,423,681 Y51C possibly damaging Het
Actl9 T A 17: 33,434,198 Y411N possibly damaging Het
Ano4 A G 10: 88,993,029 V516A probably damaging Het
Bptf A T 11: 107,054,788 S2542T probably damaging Het
Card11 C T 5: 140,876,408 V1045M probably damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cdh3 A G 8: 106,541,490 K386E possibly damaging Het
Cks1b C A 3: 89,416,314 Q49H probably damaging Het
Clpb A T 7: 101,663,932 D41V probably benign Het
Cyp3a11 A T 5: 145,860,492 M359K probably damaging Het
Cyp3a13 A T 5: 137,909,966 I207N probably benign Het
Dennd4c T A 4: 86,799,464 L566* probably null Het
Dhtkd1 A T 2: 5,899,995 D859E probably benign Het
Efcab6 T C 15: 83,973,313 D295G probably benign Het
Fcgbp A G 7: 28,075,273 T91A possibly damaging Het
Gm11569 GCAGCTGGGCCTGCAGCAGCTGGAAATGCAGCAGCTAGGACGGCAACA GCA 11: 99,798,665 probably benign Het
Gm884 A T 11: 103,618,201 H980Q unknown Het
Gsdma3 A G 11: 98,638,054 K454E unknown Het
Herc1 T A 9: 66,372,389 I193N probably damaging Het
Kdm5b T A 1: 134,628,685 L1370Q probably damaging Het
Map4 T G 9: 110,072,614 V965G probably damaging Het
Mkrn2os T C 6: 115,585,483 D173G probably benign Het
Ndfip2 A G 14: 105,294,866 D232G probably damaging Het
Nipal2 C T 15: 34,584,729 G231D probably damaging Het
Notch3 A T 17: 32,154,763 N490K probably damaging Het
Olfr150 T A 9: 39,737,239 C141* probably null Het
Olfr493 A G 7: 108,346,322 S220P possibly damaging Het
Prkar2a T C 9: 108,733,127 L185S probably damaging Het
Ptpn9 T G 9: 57,061,003 N542K probably damaging Het
Pus10 G A 11: 23,712,326 probably null Het
Pyroxd2 A G 19: 42,740,389 S191P probably benign Het
Rab15 T A 12: 76,801,942 K122* probably null Het
Rara A G 11: 98,973,495 N416S possibly damaging Het
Rims2 T C 15: 39,476,520 V870A possibly damaging Het
Sec16a T C 2: 26,425,773 T293A Het
Slc26a3 G A 12: 31,470,950 D718N probably benign Het
Slc44a5 G A 3: 154,259,022 V520I possibly damaging Het
Tgfb2 A T 1: 186,690,727 Y142N probably benign Het
Tgfbi A T 13: 56,629,794 I364F probably damaging Het
Tmem144 A C 3: 79,826,867 D176E probably benign Het
Tns4 A T 11: 99,071,335 L612Q probably damaging Het
Trank1 T C 9: 111,390,107 F1971L probably damaging Het
Tsen54 G T 11: 115,822,596 V481F probably damaging Het
Uimc1 A G 13: 55,075,568 L297P probably damaging Het
Wnt8a T C 18: 34,547,583 Y334H probably damaging Het
Zfp281 A G 1: 136,627,003 D573G possibly damaging Het
Other mutations in Toe1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02806:Toe1 APN 4 116806330 missense possibly damaging 0.83
F5770:Toe1 UTSW 4 116806111 missense probably damaging 1.00
R0501:Toe1 UTSW 4 116807485 missense probably benign
R0639:Toe1 UTSW 4 116806750 missense probably benign
R1768:Toe1 UTSW 4 116804879 missense probably benign 0.04
R1860:Toe1 UTSW 4 116805229 missense probably damaging 1.00
R2926:Toe1 UTSW 4 116804980 missense possibly damaging 0.67
R4722:Toe1 UTSW 4 116805200 missense probably damaging 1.00
R4926:Toe1 UTSW 4 116804532 missense probably damaging 0.99
R5195:Toe1 UTSW 4 116804655 missense probably damaging 1.00
R6898:Toe1 UTSW 4 116807474 missense probably damaging 1.00
R7241:Toe1 UTSW 4 116807518 start codon destroyed probably null 0.95
T0722:Toe1 UTSW 4 116806093 missense probably benign 0.00
T0975:Toe1 UTSW 4 116806093 missense probably benign 0.00
V7581:Toe1 UTSW 4 116806111 missense probably damaging 1.00
V7582:Toe1 UTSW 4 116806111 missense probably damaging 1.00
V7583:Toe1 UTSW 4 116806111 missense probably damaging 1.00
X0028:Toe1 UTSW 4 116806052 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTATCTGGTTGCTGCCTGAAGC -3'
(R):5'- TGGCCATCACTCTTGCTAGC -3'

Sequencing Primer
(F):5'- GTCCTGGCAGCATGACACAC -3'
(R):5'- CCTTAAAGACAGCTAGCTTTGTGGC -3'
Posted On2019-06-07