Incidental Mutation 'PIT4486001:Cyp3a13'
ID556096
Institutional Source Beutler Lab
Gene Symbol Cyp3a13
Ensembl Gene ENSMUSG00000029727
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 13
Synonymssteroid inducible, IIIAm2
Accession Numbers

Genbank: NM_007819

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4486001 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location137892932-137921619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 137909966 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 207 (I207N)
Ref Sequence ENSEMBL: ENSMUSP00000031741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031741]
Predicted Effect probably benign
Transcript: ENSMUST00000031741
AA Change: I207N

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000031741
Gene: ENSMUSG00000029727
AA Change: I207N

DomainStartEndE-ValueType
low complexity region 14 24 N/A INTRINSIC
Pfam:p450 38 493 1.3e-130 PFAM
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.5%
  • 10x: 84.1%
  • 20x: 70.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes, which participate in drug metabolism and the synthesis of cholesterol, steroids and other lipids. This enzyme hydroxylates testosterone and dehydroepiandrosterone 3-sulphate, which is involved in the formation of estriol during pregnancy. This gene is part of a cluster of related genes on chromosome 7q21.1. Naturally-occurring readthrough transcription occurs between this gene and the downstream CYP3A51P pseudogene and is represented by GeneID:100861540. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a knock-out allele show no apparent alterations in hematology, plasma clinical chemistry or pathology. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T C 5: 145,044,104 S108P probably damaging Het
4930548H24Rik T A 5: 31,487,743 I280K probably damaging Het
4931408C20Rik G A 1: 26,685,329 P257S probably damaging Het
Abhd16b A T 2: 181,493,959 Q218L probably benign Het
Abhd3 T A 18: 10,645,233 I354F probably benign Het
Abt1 T C 13: 23,423,681 Y51C possibly damaging Het
Actl9 T A 17: 33,434,198 Y411N possibly damaging Het
Ano4 A G 10: 88,993,029 V516A probably damaging Het
Bptf A T 11: 107,054,788 S2542T probably damaging Het
Card11 C T 5: 140,876,408 V1045M probably damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cdh3 A G 8: 106,541,490 K386E possibly damaging Het
Cks1b C A 3: 89,416,314 Q49H probably damaging Het
Clpb A T 7: 101,663,932 D41V probably benign Het
Cyp3a11 A T 5: 145,860,492 M359K probably damaging Het
Dennd4c T A 4: 86,799,464 L566* probably null Het
Dhtkd1 A T 2: 5,899,995 D859E probably benign Het
Efcab6 T C 15: 83,973,313 D295G probably benign Het
Fcgbp A G 7: 28,075,273 T91A possibly damaging Het
Gm11569 GCAGCTGGGCCTGCAGCAGCTGGAAATGCAGCAGCTAGGACGGCAACA GCA 11: 99,798,665 probably benign Het
Gm884 A T 11: 103,618,201 H980Q unknown Het
Gsdma3 A G 11: 98,638,054 K454E unknown Het
Herc1 T A 9: 66,372,389 I193N probably damaging Het
Kdm5b T A 1: 134,628,685 L1370Q probably damaging Het
Map4 T G 9: 110,072,614 V965G probably damaging Het
Mkrn2os T C 6: 115,585,483 D173G probably benign Het
Ndfip2 A G 14: 105,294,866 D232G probably damaging Het
Nipal2 C T 15: 34,584,729 G231D probably damaging Het
Notch3 A T 17: 32,154,763 N490K probably damaging Het
Olfr150 T A 9: 39,737,239 C141* probably null Het
Olfr493 A G 7: 108,346,322 S220P possibly damaging Het
Prkar2a T C 9: 108,733,127 L185S probably damaging Het
Ptpn9 T G 9: 57,061,003 N542K probably damaging Het
Pus10 G A 11: 23,712,326 probably null Het
Pyroxd2 A G 19: 42,740,389 S191P probably benign Het
Rab15 T A 12: 76,801,942 K122* probably null Het
Rara A G 11: 98,973,495 N416S possibly damaging Het
Rims2 T C 15: 39,476,520 V870A possibly damaging Het
Sec16a T C 2: 26,425,773 T293A Het
Slc26a3 G A 12: 31,470,950 D718N probably benign Het
Slc44a5 G A 3: 154,259,022 V520I possibly damaging Het
Tgfb2 A T 1: 186,690,727 Y142N probably benign Het
Tgfbi A T 13: 56,629,794 I364F probably damaging Het
Tmem144 A C 3: 79,826,867 D176E probably benign Het
Tns4 A T 11: 99,071,335 L612Q probably damaging Het
Toe1 A G 4: 116,806,495 L76S probably damaging Het
Trank1 T C 9: 111,390,107 F1971L probably damaging Het
Tsen54 G T 11: 115,822,596 V481F probably damaging Het
Uimc1 A G 13: 55,075,568 L297P probably damaging Het
Wnt8a T C 18: 34,547,583 Y334H probably damaging Het
Zfp281 A G 1: 136,627,003 D573G possibly damaging Het
Other mutations in Cyp3a13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Cyp3a13 APN 5 137911933 missense probably benign 0.08
IGL01879:Cyp3a13 APN 5 137919003 missense probably benign
IGL01886:Cyp3a13 APN 5 137898820 missense probably damaging 1.00
IGL02048:Cyp3a13 APN 5 137918995 splice site probably benign
IGL02102:Cyp3a13 APN 5 137911603 missense probably benign 0.00
IGL02285:Cyp3a13 APN 5 137909967 missense probably benign 0.38
IGL03213:Cyp3a13 APN 5 137894267 utr 3 prime probably benign
IGL03238:Cyp3a13 APN 5 137898889 missense probably damaging 0.99
G4846:Cyp3a13 UTSW 5 137898823 missense possibly damaging 0.55
IGL02988:Cyp3a13 UTSW 5 137899010 nonsense probably null
R0319:Cyp3a13 UTSW 5 137898862 missense probably damaging 1.00
R1024:Cyp3a13 UTSW 5 137894364 missense possibly damaging 0.56
R1189:Cyp3a13 UTSW 5 137911630 splice site probably null
R1464:Cyp3a13 UTSW 5 137905565 missense possibly damaging 0.83
R1464:Cyp3a13 UTSW 5 137905565 missense possibly damaging 0.83
R1501:Cyp3a13 UTSW 5 137911630 splice site probably null
R1838:Cyp3a13 UTSW 5 137911632 splice site probably null
R1956:Cyp3a13 UTSW 5 137909942 missense probably benign 0.02
R1981:Cyp3a13 UTSW 5 137911856 missense probably damaging 0.97
R2048:Cyp3a13 UTSW 5 137909975 missense probably damaging 0.98
R2140:Cyp3a13 UTSW 5 137921454 missense possibly damaging 0.93
R4844:Cyp3a13 UTSW 5 137917551 missense probably benign
R5001:Cyp3a13 UTSW 5 137898916 missense probably benign 0.00
R5062:Cyp3a13 UTSW 5 137898899 missense possibly damaging 0.52
R5420:Cyp3a13 UTSW 5 137898981 missense probably damaging 1.00
R5855:Cyp3a13 UTSW 5 137919056 missense probably damaging 0.98
R6089:Cyp3a13 UTSW 5 137909953 missense probably benign 0.07
R6927:Cyp3a13 UTSW 5 137895284 missense probably damaging 1.00
R6978:Cyp3a13 UTSW 5 137905539 missense probably benign 0.01
R7283:Cyp3a13 UTSW 5 137905556 missense probably benign 0.01
R7571:Cyp3a13 UTSW 5 137898863 missense possibly damaging 0.93
R7781:Cyp3a13 UTSW 5 137898874 missense possibly damaging 0.94
R8281:Cyp3a13 UTSW 5 137894297 missense probably benign 0.01
RF007:Cyp3a13 UTSW 5 137894263 makesense probably null
RF020:Cyp3a13 UTSW 5 137894263 makesense probably null
X0024:Cyp3a13 UTSW 5 137900391 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACCCACAGTCCCTTCAGT -3'
(R):5'- ACATGTGAACTTACTACTGCTTCAT -3'

Sequencing Primer
(F):5'- ATGTTCCACAGCTAGCAGTG -3'
(R):5'- GAACTTACTACTGCTTCATACTCTG -3'
Posted On2019-06-07