Incidental Mutation 'PIT4486001:Cyp3a11'
ID556099
Institutional Source Beutler Lab
Gene Symbol Cyp3a11
Ensembl Gene ENSMUSG00000056035
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 11
SynonymsIIIAm1, Cyp3a, Pcn
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4486001 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location145854426-145879964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 145860492 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 359 (M359K)
Ref Sequence ENSEMBL: ENSMUSP00000037665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035918]
Predicted Effect probably damaging
Transcript: ENSMUST00000035918
AA Change: M359K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037665
Gene: ENSMUSG00000056035
AA Change: M359K

DomainStartEndE-ValueType
Pfam:p450 38 494 2.4e-136 PFAM
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.5%
  • 10x: 84.1%
  • 20x: 70.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T C 5: 145,044,104 S108P probably damaging Het
4930548H24Rik T A 5: 31,487,743 I280K probably damaging Het
4931408C20Rik G A 1: 26,685,329 P257S probably damaging Het
Abhd16b A T 2: 181,493,959 Q218L probably benign Het
Abhd3 T A 18: 10,645,233 I354F probably benign Het
Abt1 T C 13: 23,423,681 Y51C possibly damaging Het
Actl9 T A 17: 33,434,198 Y411N possibly damaging Het
Ano4 A G 10: 88,993,029 V516A probably damaging Het
Bptf A T 11: 107,054,788 S2542T probably damaging Het
Card11 C T 5: 140,876,408 V1045M probably damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cdh3 A G 8: 106,541,490 K386E possibly damaging Het
Cks1b C A 3: 89,416,314 Q49H probably damaging Het
Clpb A T 7: 101,663,932 D41V probably benign Het
Cyp3a13 A T 5: 137,909,966 I207N probably benign Het
Dennd4c T A 4: 86,799,464 L566* probably null Het
Dhtkd1 A T 2: 5,899,995 D859E probably benign Het
Efcab6 T C 15: 83,973,313 D295G probably benign Het
Fcgbp A G 7: 28,075,273 T91A possibly damaging Het
Gm11569 GCAGCTGGGCCTGCAGCAGCTGGAAATGCAGCAGCTAGGACGGCAACA GCA 11: 99,798,665 probably benign Het
Gm884 A T 11: 103,618,201 H980Q unknown Het
Gsdma3 A G 11: 98,638,054 K454E unknown Het
Herc1 T A 9: 66,372,389 I193N probably damaging Het
Kdm5b T A 1: 134,628,685 L1370Q probably damaging Het
Map4 T G 9: 110,072,614 V965G probably damaging Het
Mkrn2os T C 6: 115,585,483 D173G probably benign Het
Ndfip2 A G 14: 105,294,866 D232G probably damaging Het
Nipal2 C T 15: 34,584,729 G231D probably damaging Het
Notch3 A T 17: 32,154,763 N490K probably damaging Het
Olfr150 T A 9: 39,737,239 C141* probably null Het
Olfr493 A G 7: 108,346,322 S220P possibly damaging Het
Prkar2a T C 9: 108,733,127 L185S probably damaging Het
Ptpn9 T G 9: 57,061,003 N542K probably damaging Het
Pus10 G A 11: 23,712,326 probably null Het
Pyroxd2 A G 19: 42,740,389 S191P probably benign Het
Rab15 T A 12: 76,801,942 K122* probably null Het
Rara A G 11: 98,973,495 N416S possibly damaging Het
Rims2 T C 15: 39,476,520 V870A possibly damaging Het
Sec16a T C 2: 26,425,773 T293A Het
Slc26a3 G A 12: 31,470,950 D718N probably benign Het
Slc44a5 G A 3: 154,259,022 V520I possibly damaging Het
Tgfb2 A T 1: 186,690,727 Y142N probably benign Het
Tgfbi A T 13: 56,629,794 I364F probably damaging Het
Tmem144 A C 3: 79,826,867 D176E probably benign Het
Tns4 A T 11: 99,071,335 L612Q probably damaging Het
Toe1 A G 4: 116,806,495 L76S probably damaging Het
Trank1 T C 9: 111,390,107 F1971L probably damaging Het
Tsen54 G T 11: 115,822,596 V481F probably damaging Het
Uimc1 A G 13: 55,075,568 L297P probably damaging Het
Wnt8a T C 18: 34,547,583 Y334H probably damaging Het
Zfp281 A G 1: 136,627,003 D573G possibly damaging Het
Other mutations in Cyp3a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Cyp3a11 APN 5 145862465 missense probably damaging 1.00
IGL01316:Cyp3a11 APN 5 145855151 missense possibly damaging 0.78
IGL01348:Cyp3a11 APN 5 145869007 missense possibly damaging 0.80
IGL01591:Cyp3a11 APN 5 145875481 splice site probably benign
IGL01665:Cyp3a11 APN 5 145868665 missense probably benign 0.00
IGL02203:Cyp3a11 APN 5 145869166 missense probably damaging 1.00
IGL02894:Cyp3a11 APN 5 145869026 nonsense probably null
IGL03201:Cyp3a11 APN 5 145860379 missense possibly damaging 0.94
IGL03342:Cyp3a11 APN 5 145855117 missense probably damaging 0.96
R0347:Cyp3a11 UTSW 5 145865925 missense possibly damaging 0.93
R0376:Cyp3a11 UTSW 5 145862452 nonsense probably null
R0378:Cyp3a11 UTSW 5 145868607 missense probably benign 0.43
R0448:Cyp3a11 UTSW 5 145862394 missense probably benign 0.00
R0567:Cyp3a11 UTSW 5 145869149 missense probably damaging 1.00
R0968:Cyp3a11 UTSW 5 145862514 splice site probably benign
R1292:Cyp3a11 UTSW 5 145865994 missense probably benign 0.04
R1400:Cyp3a11 UTSW 5 145862489 missense probably damaging 0.98
R1478:Cyp3a11 UTSW 5 145858771 missense probably benign 0.01
R1520:Cyp3a11 UTSW 5 145862453 missense probably damaging 1.00
R1716:Cyp3a11 UTSW 5 145868966 missense probably benign
R2060:Cyp3a11 UTSW 5 145855081 missense probably benign 0.00
R2076:Cyp3a11 UTSW 5 145879766 missense probably benign
R2227:Cyp3a11 UTSW 5 145868547 missense possibly damaging 0.90
R3725:Cyp3a11 UTSW 5 145866000 missense probably benign 0.02
R4222:Cyp3a11 UTSW 5 145860466 missense probably damaging 0.99
R4256:Cyp3a11 UTSW 5 145869195 missense probably benign 0.04
R4294:Cyp3a11 UTSW 5 145869195 missense probably benign 0.04
R4852:Cyp3a11 UTSW 5 145860495 missense probably damaging 1.00
R5229:Cyp3a11 UTSW 5 145855135 missense probably benign 0.00
R5285:Cyp3a11 UTSW 5 145855083 missense probably benign 0.00
R5590:Cyp3a11 UTSW 5 145865977 missense probably benign 0.00
R5703:Cyp3a11 UTSW 5 145860373 missense probably benign
R5786:Cyp3a11 UTSW 5 145862474 missense possibly damaging 0.47
R6291:Cyp3a11 UTSW 5 145862427 missense possibly damaging 0.89
R6405:Cyp3a11 UTSW 5 145862420 missense probably damaging 0.96
R6892:Cyp3a11 UTSW 5 145860448 missense probably damaging 0.98
R7114:Cyp3a11 UTSW 5 145858783 missense probably benign 0.16
R7243:Cyp3a11 UTSW 5 145858803 missense probably damaging 0.96
R7438:Cyp3a11 UTSW 5 145865900 missense probably benign 0.39
R7611:Cyp3a11 UTSW 5 145860381 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TTGGAATTCTTCAGGCTCTGACC -3'
(R):5'- GGTGTTTAAATCATCCCACCTCTC -3'

Sequencing Primer
(F):5'- TTCAGGCTCTGACCAGTGCTG -3'
(R):5'- GGATCCATTCATATTGGAGTCCCAG -3'
Posted On2019-06-07