Incidental Mutation 'PIT4486001:Olfr150'
ID556105
Institutional Source Beutler Lab
Gene Symbol Olfr150
Ensembl Gene ENSMUSG00000094353
Gene Nameolfactory receptor 150
SynonymsGA_x6K02T2PVTD-33434302-33435240, MOR171-18, M93
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #PIT4486001 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location39730978-39738456 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 39737239 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 141 (C141*)
Ref Sequence ENSEMBL: ENSMUSP00000150024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078557] [ENSMUST00000217257]
Predicted Effect probably null
Transcript: ENSMUST00000078557
AA Change: C141*
SMART Domains Protein: ENSMUSP00000077635
Gene: ENSMUSG00000094353
AA Change: C141*

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.7e-50 PFAM
Pfam:7tm_1 41 290 1.3e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000217257
AA Change: C141*
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.5%
  • 10x: 84.1%
  • 20x: 70.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T C 5: 145,044,104 S108P probably damaging Het
4930548H24Rik T A 5: 31,487,743 I280K probably damaging Het
4931408C20Rik G A 1: 26,685,329 P257S probably damaging Het
Abhd16b A T 2: 181,493,959 Q218L probably benign Het
Abhd3 T A 18: 10,645,233 I354F probably benign Het
Abt1 T C 13: 23,423,681 Y51C possibly damaging Het
Actl9 T A 17: 33,434,198 Y411N possibly damaging Het
Ano4 A G 10: 88,993,029 V516A probably damaging Het
Bptf A T 11: 107,054,788 S2542T probably damaging Het
Card11 C T 5: 140,876,408 V1045M probably damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cdh3 A G 8: 106,541,490 K386E possibly damaging Het
Cks1b C A 3: 89,416,314 Q49H probably damaging Het
Clpb A T 7: 101,663,932 D41V probably benign Het
Cyp3a11 A T 5: 145,860,492 M359K probably damaging Het
Cyp3a13 A T 5: 137,909,966 I207N probably benign Het
Dennd4c T A 4: 86,799,464 L566* probably null Het
Dhtkd1 A T 2: 5,899,995 D859E probably benign Het
Efcab6 T C 15: 83,973,313 D295G probably benign Het
Fcgbp A G 7: 28,075,273 T91A possibly damaging Het
Gm11569 GCAGCTGGGCCTGCAGCAGCTGGAAATGCAGCAGCTAGGACGGCAACA GCA 11: 99,798,665 probably benign Het
Gm884 A T 11: 103,618,201 H980Q unknown Het
Gsdma3 A G 11: 98,638,054 K454E unknown Het
Herc1 T A 9: 66,372,389 I193N probably damaging Het
Kdm5b T A 1: 134,628,685 L1370Q probably damaging Het
Map4 T G 9: 110,072,614 V965G probably damaging Het
Mkrn2os T C 6: 115,585,483 D173G probably benign Het
Ndfip2 A G 14: 105,294,866 D232G probably damaging Het
Nipal2 C T 15: 34,584,729 G231D probably damaging Het
Notch3 A T 17: 32,154,763 N490K probably damaging Het
Olfr493 A G 7: 108,346,322 S220P possibly damaging Het
Prkar2a T C 9: 108,733,127 L185S probably damaging Het
Ptpn9 T G 9: 57,061,003 N542K probably damaging Het
Pus10 G A 11: 23,712,326 probably null Het
Pyroxd2 A G 19: 42,740,389 S191P probably benign Het
Rab15 T A 12: 76,801,942 K122* probably null Het
Rara A G 11: 98,973,495 N416S possibly damaging Het
Rims2 T C 15: 39,476,520 V870A possibly damaging Het
Sec16a T C 2: 26,425,773 T293A Het
Slc26a3 G A 12: 31,470,950 D718N probably benign Het
Slc44a5 G A 3: 154,259,022 V520I possibly damaging Het
Tgfb2 A T 1: 186,690,727 Y142N probably benign Het
Tgfbi A T 13: 56,629,794 I364F probably damaging Het
Tmem144 A C 3: 79,826,867 D176E probably benign Het
Tns4 A T 11: 99,071,335 L612Q probably damaging Het
Toe1 A G 4: 116,806,495 L76S probably damaging Het
Trank1 T C 9: 111,390,107 F1971L probably damaging Het
Tsen54 G T 11: 115,822,596 V481F probably damaging Het
Uimc1 A G 13: 55,075,568 L297P probably damaging Het
Wnt8a T C 18: 34,547,583 Y334H probably damaging Het
Zfp281 A G 1: 136,627,003 D573G possibly damaging Het
Other mutations in Olfr150
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Olfr150 APN 9 39737499 missense probably damaging 1.00
IGL01110:Olfr150 APN 9 39737397 missense probably benign 0.00
IGL01343:Olfr150 APN 9 39737715 missense probably damaging 0.99
IGL01942:Olfr150 APN 9 39737666 missense possibly damaging 0.90
IGL02044:Olfr150 APN 9 39736974 missense possibly damaging 0.94
R1178:Olfr150 UTSW 9 39737346 missense probably damaging 1.00
R1451:Olfr150 UTSW 9 39737316 missense probably benign 0.00
R1672:Olfr150 UTSW 9 39737196 missense probably damaging 1.00
R1916:Olfr150 UTSW 9 39737622 missense probably benign 0.06
R2095:Olfr150 UTSW 9 39737261 missense probably damaging 0.98
R2116:Olfr150 UTSW 9 39737304 missense probably damaging 0.98
R4183:Olfr150 UTSW 9 39737048 missense probably benign 0.01
R4259:Olfr150 UTSW 9 39737703 missense probably damaging 1.00
R4590:Olfr150 UTSW 9 39736850 missense probably damaging 1.00
R5188:Olfr150 UTSW 9 39737235 missense probably benign 0.00
R6158:Olfr150 UTSW 9 39737076 missense probably benign
R6361:Olfr150 UTSW 9 39737672 missense probably damaging 1.00
R6807:Olfr150 UTSW 9 39737618 nonsense probably null
R6977:Olfr150 UTSW 9 39737034 missense probably benign 0.01
R7412:Olfr150 UTSW 9 39737126 missense probably benign 0.24
R8755:Olfr150 UTSW 9 39737490 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTGGTGAACTTTGTGACAAC -3'
(R):5'- ACCCAGGATAGTCAATGTTGG -3'

Sequencing Primer
(F):5'- GGCTGCAATGGCATATGA -3'
(R):5'- GAGACAGGAGTACTACCTCATTGAC -3'
Posted On2019-06-07