Incidental Mutation 'PIT4486001:Map4'
ID556109
Institutional Source Beutler Lab
Gene Symbol Map4
Ensembl Gene ENSMUSG00000032479
Gene Namemicrotubule-associated protein 4
SynonymsMtap4, MAP 4
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4486001 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location109931460-110083955 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 110072614 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 965 (V965G)
Ref Sequence ENSEMBL: ENSMUSP00000035055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035055] [ENSMUST00000163979] [ENSMUST00000164930] [ENSMUST00000165876] [ENSMUST00000198511] [ENSMUST00000199161] [ENSMUST00000199461] [ENSMUST00000199498] [ENSMUST00000199548]
Predicted Effect probably damaging
Transcript: ENSMUST00000035055
AA Change: V965G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035055
Gene: ENSMUSG00000032479
AA Change: V965G

DomainStartEndE-ValueType
low complexity region 254 265 N/A INTRINSIC
internal_repeat_1 266 379 4.96e-7 PROSPERO
low complexity region 401 420 N/A INTRINSIC
internal_repeat_1 439 550 4.96e-7 PROSPERO
low complexity region 659 674 N/A INTRINSIC
low complexity region 720 742 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
Pfam:Tubulin-binding 903 926 2e-12 PFAM
Pfam:Tubulin-binding 965 995 4.9e-18 PFAM
Pfam:Tubulin-binding 996 1026 7.4e-18 PFAM
Pfam:Tubulin-binding 1027 1058 4.4e-15 PFAM
low complexity region 1093 1108 N/A INTRINSIC
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000163979
AA Change: V254G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129362
Gene: ENSMUSG00000032479
AA Change: V254G

DomainStartEndE-ValueType
low complexity region 9 17 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
low complexity region 506 521 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 607 622 N/A INTRINSIC
low complexity region 726 736 N/A INTRINSIC
Pfam:Tubulin-binding 743 773 5.8e-16 PFAM
Pfam:Tubulin-binding 774 804 2.2e-18 PFAM
Pfam:Tubulin-binding 805 836 1.6e-11 PFAM
low complexity region 871 886 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164930
AA Change: V774G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131285
Gene: ENSMUSG00000032479
AA Change: V774G

DomainStartEndE-ValueType
low complexity region 9 17 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
low complexity region 506 521 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 607 622 N/A INTRINSIC
low complexity region 726 736 N/A INTRINSIC
Pfam:Tubulin-binding 743 773 6e-16 PFAM
Pfam:Tubulin-binding 774 804 4.5e-19 PFAM
Pfam:Tubulin-binding 805 835 2.3e-18 PFAM
Pfam:Tubulin-binding 836 867 1.6e-11 PFAM
low complexity region 902 917 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165876
AA Change: V965G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132662
Gene: ENSMUSG00000032479
AA Change: V965G

DomainStartEndE-ValueType
low complexity region 254 265 N/A INTRINSIC
internal_repeat_1 266 379 4.95e-7 PROSPERO
low complexity region 401 420 N/A INTRINSIC
internal_repeat_1 439 550 4.95e-7 PROSPERO
low complexity region 659 674 N/A INTRINSIC
low complexity region 720 742 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
Pfam:Tubulin-binding 896 926 8.5e-16 PFAM
Pfam:Tubulin-binding 965 995 6.4e-19 PFAM
Pfam:Tubulin-binding 996 1026 3.3e-18 PFAM
Pfam:Tubulin-binding 1027 1058 2.3e-11 PFAM
low complexity region 1093 1108 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198511
AA Change: V55G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142558
Gene: ENSMUSG00000032479
AA Change: V55G

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
Pfam:Tubulin-binding 24 54 7.3e-14 PFAM
Pfam:Tubulin-binding 55 85 5.3e-17 PFAM
Pfam:Tubulin-binding 86 116 2.8e-16 PFAM
Pfam:Tubulin-binding 117 148 1.9e-9 PFAM
low complexity region 183 198 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199161
AA Change: V47G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143205
Gene: ENSMUSG00000032479
AA Change: V47G

DomainStartEndE-ValueType
Pfam:Tubulin-binding 16 46 6.7e-14 PFAM
Pfam:Tubulin-binding 47 77 4.9e-17 PFAM
Pfam:Tubulin-binding 78 108 2.5e-16 PFAM
Pfam:Tubulin-binding 109 140 1.7e-9 PFAM
low complexity region 176 191 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199461
SMART Domains Protein: ENSMUSP00000143296
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
Pfam:Tubulin-binding 116 146 1e-13 PFAM
Pfam:Tubulin-binding 147 177 3.8e-16 PFAM
Pfam:Tubulin-binding 178 209 2.6e-9 PFAM
low complexity region 244 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199498
SMART Domains Protein: ENSMUSP00000142439
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
low complexity region 9 17 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
low complexity region 506 521 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 607 622 N/A INTRINSIC
low complexity region 726 736 N/A INTRINSIC
Pfam:Tubulin-binding 743 773 5.8e-16 PFAM
Pfam:Tubulin-binding 774 804 2.2e-18 PFAM
Pfam:Tubulin-binding 805 836 1.6e-11 PFAM
low complexity region 871 886 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199548
AA Change: V147G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143408
Gene: ENSMUSG00000032479
AA Change: V147G

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
Pfam:Tubulin-binding 116 146 1.1e-13 PFAM
Pfam:Tubulin-binding 147 177 7.9e-17 PFAM
Pfam:Tubulin-binding 178 208 4.1e-16 PFAM
Pfam:Tubulin-binding 209 240 2.8e-9 PFAM
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.5%
  • 10x: 84.1%
  • 20x: 70.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a major non-neuronal microtubule-associated protein. This protein contains a domain similar to the microtubule-binding domains of neuronal microtubule-associated protein (MAP2) and microtubule-associated protein tau (MAPT/TAU). This protein promotes microtubule assembly, and has been shown to counteract destabilization of interphase microtubule catastrophe promotion. Cyclin B was found to interact with this protein, which targets cell division cycle 2 (CDC2) kinase to microtubules. The phosphorylation of this protein affects microtubule properties and cell cycle progression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and do not display any overt phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T C 5: 145,044,104 S108P probably damaging Het
4930548H24Rik T A 5: 31,487,743 I280K probably damaging Het
4931408C20Rik G A 1: 26,685,329 P257S probably damaging Het
Abhd16b A T 2: 181,493,959 Q218L probably benign Het
Abhd3 T A 18: 10,645,233 I354F probably benign Het
Abt1 T C 13: 23,423,681 Y51C possibly damaging Het
Actl9 T A 17: 33,434,198 Y411N possibly damaging Het
Ano4 A G 10: 88,993,029 V516A probably damaging Het
Bptf A T 11: 107,054,788 S2542T probably damaging Het
Card11 C T 5: 140,876,408 V1045M probably damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cdh3 A G 8: 106,541,490 K386E possibly damaging Het
Cks1b C A 3: 89,416,314 Q49H probably damaging Het
Clpb A T 7: 101,663,932 D41V probably benign Het
Cyp3a11 A T 5: 145,860,492 M359K probably damaging Het
Cyp3a13 A T 5: 137,909,966 I207N probably benign Het
Dennd4c T A 4: 86,799,464 L566* probably null Het
Dhtkd1 A T 2: 5,899,995 D859E probably benign Het
Efcab6 T C 15: 83,973,313 D295G probably benign Het
Fcgbp A G 7: 28,075,273 T91A possibly damaging Het
Gm11569 GCAGCTGGGCCTGCAGCAGCTGGAAATGCAGCAGCTAGGACGGCAACA GCA 11: 99,798,665 probably benign Het
Gm884 A T 11: 103,618,201 H980Q unknown Het
Gsdma3 A G 11: 98,638,054 K454E unknown Het
Herc1 T A 9: 66,372,389 I193N probably damaging Het
Kdm5b T A 1: 134,628,685 L1370Q probably damaging Het
Mkrn2os T C 6: 115,585,483 D173G probably benign Het
Ndfip2 A G 14: 105,294,866 D232G probably damaging Het
Nipal2 C T 15: 34,584,729 G231D probably damaging Het
Notch3 A T 17: 32,154,763 N490K probably damaging Het
Olfr150 T A 9: 39,737,239 C141* probably null Het
Olfr493 A G 7: 108,346,322 S220P possibly damaging Het
Prkar2a T C 9: 108,733,127 L185S probably damaging Het
Ptpn9 T G 9: 57,061,003 N542K probably damaging Het
Pus10 G A 11: 23,712,326 probably null Het
Pyroxd2 A G 19: 42,740,389 S191P probably benign Het
Rab15 T A 12: 76,801,942 K122* probably null Het
Rara A G 11: 98,973,495 N416S possibly damaging Het
Rims2 T C 15: 39,476,520 V870A possibly damaging Het
Sec16a T C 2: 26,425,773 T293A Het
Slc26a3 G A 12: 31,470,950 D718N probably benign Het
Slc44a5 G A 3: 154,259,022 V520I possibly damaging Het
Tgfb2 A T 1: 186,690,727 Y142N probably benign Het
Tgfbi A T 13: 56,629,794 I364F probably damaging Het
Tmem144 A C 3: 79,826,867 D176E probably benign Het
Tns4 A T 11: 99,071,335 L612Q probably damaging Het
Toe1 A G 4: 116,806,495 L76S probably damaging Het
Trank1 T C 9: 111,390,107 F1971L probably damaging Het
Tsen54 G T 11: 115,822,596 V481F probably damaging Het
Uimc1 A G 13: 55,075,568 L297P probably damaging Het
Wnt8a T C 18: 34,547,583 Y334H probably damaging Het
Zfp281 A G 1: 136,627,003 D573G possibly damaging Het
Other mutations in Map4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Map4 APN 9 110072604 splice site probably benign
IGL01331:Map4 APN 9 110034801 missense probably benign 0.04
IGL01599:Map4 APN 9 110034768 missense probably benign 0.26
IGL01631:Map4 APN 9 110063133 unclassified probably benign
IGL02208:Map4 APN 9 109978870 start codon destroyed probably null 1.00
IGL02455:Map4 APN 9 109999833 missense probably benign 0.15
IGL02625:Map4 APN 9 110064417 missense probably damaging 1.00
R0149:Map4 UTSW 9 110067624 missense probably damaging 0.96
R0384:Map4 UTSW 9 110034628 missense probably damaging 0.99
R0392:Map4 UTSW 9 110078045 missense probably damaging 1.00
R0496:Map4 UTSW 9 110039850 intron probably benign
R0526:Map4 UTSW 9 110037278 splice site probably null
R0555:Map4 UTSW 9 109979103 splice site probably benign
R0571:Map4 UTSW 9 110036766 missense probably benign 0.00
R0698:Map4 UTSW 9 110068788 nonsense probably null
R0762:Map4 UTSW 9 110038478 intron probably benign
R0862:Map4 UTSW 9 109978969 missense probably damaging 1.00
R0864:Map4 UTSW 9 109978969 missense probably damaging 1.00
R1168:Map4 UTSW 9 110034964 missense probably benign 0.00
R1238:Map4 UTSW 9 110068580 missense probably benign 0.00
R1735:Map4 UTSW 9 110034955 missense probably benign 0.00
R1869:Map4 UTSW 9 110034964 missense probably benign 0.00
R1869:Map4 UTSW 9 110068928 missense possibly damaging 0.95
R2196:Map4 UTSW 9 110071048 missense probably damaging 1.00
R2264:Map4 UTSW 9 110081457 missense probably damaging 1.00
R2507:Map4 UTSW 9 110037483 intron probably benign
R2512:Map4 UTSW 9 110034702 missense possibly damaging 0.48
R3087:Map4 UTSW 9 110053189 missense possibly damaging 0.84
R3154:Map4 UTSW 9 109999792 missense probably benign 0.19
R3498:Map4 UTSW 9 110035212 missense probably benign 0.03
R3547:Map4 UTSW 9 110052198 missense possibly damaging 0.61
R3751:Map4 UTSW 9 110038674 intron probably benign
R4036:Map4 UTSW 9 110032215 missense possibly damaging 0.47
R4423:Map4 UTSW 9 110067594 missense probably damaging 1.00
R4505:Map4 UTSW 9 110032185 missense probably benign 0.01
R4561:Map4 UTSW 9 110052371 missense possibly damaging 0.91
R4577:Map4 UTSW 9 110081421 missense possibly damaging 0.48
R4601:Map4 UTSW 9 110052819 missense possibly damaging 0.75
R4795:Map4 UTSW 9 110035263 missense probably benign 0.00
R4801:Map4 UTSW 9 110035257 missense probably benign 0.15
R4802:Map4 UTSW 9 110035257 missense probably benign 0.15
R4999:Map4 UTSW 9 110038377 intron probably benign
R5020:Map4 UTSW 9 110068800 missense probably benign 0.02
R5021:Map4 UTSW 9 110038089 nonsense probably null
R5049:Map4 UTSW 9 110079814 nonsense probably null
R5451:Map4 UTSW 9 110037783 intron probably benign
R5452:Map4 UTSW 9 110037783 intron probably benign
R5453:Map4 UTSW 9 110037783 intron probably benign
R5492:Map4 UTSW 9 110052382 missense possibly damaging 0.68
R5532:Map4 UTSW 9 110034678 missense probably benign 0.24
R5602:Map4 UTSW 9 110052700 missense possibly damaging 0.84
R5628:Map4 UTSW 9 110081847 missense probably benign 0.04
R5896:Map4 UTSW 9 110072634 missense possibly damaging 0.91
R6017:Map4 UTSW 9 110034619 missense probably benign 0.00
R6084:Map4 UTSW 9 110064292 missense probably damaging 1.00
R6294:Map4 UTSW 9 110002746 missense possibly damaging 0.82
R6397:Map4 UTSW 9 110027716 missense possibly damaging 0.78
R6773:Map4 UTSW 9 110034925 missense probably benign 0.00
R6997:Map4 UTSW 9 110052914 missense probably benign 0.35
R7141:Map4 UTSW 9 109978870 start codon destroyed probably null 1.00
R7187:Map4 UTSW 9 110053133 missense probably benign 0.03
R7320:Map4 UTSW 9 110081517 missense probably benign 0.24
R7469:Map4 UTSW 9 110027797 splice site probably null
R7479:Map4 UTSW 9 110068824 missense possibly damaging 0.94
R7487:Map4 UTSW 9 110027715 missense probably damaging 1.00
R7690:Map4 UTSW 9 109999793 missense probably damaging 0.99
R7780:Map4 UTSW 9 110034652 missense probably benign 0.00
R7998:Map4 UTSW 9 110079861 missense probably damaging 1.00
R8028:Map4 UTSW 9 110068744 missense probably damaging 1.00
Z1177:Map4 UTSW 9 110068523 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACATAGCTCTGTCCAGCCTG -3'
(R):5'- GGGATTCTGTGTCATCTTCCCG -3'

Sequencing Primer
(F):5'- AGCCTGCTTCTGTCTTGTG -3'
(R):5'- GTGTCATCTTCCCGCATCC -3'
Posted On2019-06-07