Incidental Mutation 'R0604:Gm4952'
ID55611
Institutional Source Beutler Lab
Gene Symbol Gm4952
Ensembl Gene ENSMUSG00000071633
Gene Namepredicted gene 4952
Synonyms
MMRRC Submission 038793-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R0604 (G1)
Quality Score191
Status Not validated
Chromosome19
Chromosomal Location12599974-12628251 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12624672 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 148 (E148G)
Ref Sequence ENSEMBL: ENSMUSP00000090607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092931] [ENSMUST00000181868]
Predicted Effect probably benign
Transcript: ENSMUST00000092931
AA Change: E148G

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000090607
Gene: ENSMUSG00000071633
AA Change: E148G

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 206 2.6e-90 PFAM
Pfam:Gly_acyl_tr_C 207 295 2.7e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181868
AA Change: E148G

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000137934
Gene: ENSMUSG00000071633
AA Change: E148G

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 206 3.7e-112 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik C A 2: 28,466,091 R60L possibly damaging Het
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Acap1 T C 11: 69,884,625 E302G probably benign Het
Adrb2 G A 18: 62,178,515 T413I possibly damaging Het
Aqr T C 2: 114,130,604 K725R probably benign Het
Braf A G 6: 39,623,697 I662T probably damaging Het
Ccdc178 A G 18: 22,067,443 S435P probably benign Het
Chd9 A G 8: 91,036,542 M2332V possibly damaging Het
Clgn T C 8: 83,424,194 V496A probably benign Het
Dnah17 A C 11: 118,121,471 S193R probably benign Het
Dntt A G 19: 41,053,149 E424G probably benign Het
Fam149a A G 8: 45,345,008 L492P probably damaging Het
Fetub T C 16: 22,935,660 Y126H possibly damaging Het
Fgfr3 A T 5: 33,732,782 Y96F probably damaging Het
Gucy2g T A 19: 55,203,087 L977F probably benign Het
Il1r1 T C 1: 40,282,246 V6A probably benign Het
Itsn2 C A 12: 4,658,189 Q832K probably benign Het
Lats1 T A 10: 7,712,661 F1014Y probably damaging Het
Mcc G A 18: 44,473,756 A536V probably damaging Het
Mtrf1 T C 14: 79,415,887 V334A possibly damaging Het
Olfr1179 T C 2: 88,402,383 T184A probably benign Het
Olfr325 T A 11: 58,581,348 M168K probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr50 T A 2: 36,794,107 Y290* probably null Het
Pard6g A G 18: 80,117,208 S179G probably damaging Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Psg27 A T 7: 18,557,072 V402D probably damaging Het
Rttn A G 18: 88,977,758 I222V probably damaging Het
Sp9 T A 2: 73,273,638 S179T probably benign Het
Tbc1d8 T A 1: 39,405,326 H184L probably damaging Het
Vmn1r69 A G 7: 10,580,654 V50A probably benign Het
Vmn2r58 A G 7: 41,860,576 F526L possibly damaging Het
Other mutations in Gm4952
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Gm4952 APN 19 12618408 missense probably damaging 1.00
IGL00990:Gm4952 APN 19 12623623 missense probably damaging 1.00
IGL01542:Gm4952 APN 19 12618407 missense possibly damaging 0.76
IGL01714:Gm4952 APN 19 12624711 missense probably benign 0.16
IGL02339:Gm4952 APN 19 12626911 missense probably damaging 0.98
IGL03068:Gm4952 APN 19 12623704 missense probably damaging 0.99
IGL03100:Gm4952 APN 19 12624719 critical splice donor site probably null
IGL03274:Gm4952 APN 19 12623596 splice site probably benign
IGL03295:Gm4952 APN 19 12618327 missense probably benign 0.39
PIT4520001:Gm4952 UTSW 19 12624684 missense probably benign 0.12
R1221:Gm4952 UTSW 19 12623695 missense possibly damaging 0.51
R1513:Gm4952 UTSW 19 12624675 missense probably damaging 0.99
R1514:Gm4952 UTSW 19 12626914 missense probably damaging 1.00
R1804:Gm4952 UTSW 19 12618420 missense probably damaging 0.98
R1928:Gm4952 UTSW 19 12623609 missense probably damaging 0.99
R2447:Gm4952 UTSW 19 12618406 missense possibly damaging 0.70
R4930:Gm4952 UTSW 19 12627012 missense probably benign 0.00
R5360:Gm4952 UTSW 19 12623629 missense probably benign 0.08
R5704:Gm4952 UTSW 19 12626911 missense probably damaging 1.00
R7143:Gm4952 UTSW 19 12618407 missense possibly damaging 0.76
R7332:Gm4952 UTSW 19 12627009 missense probably damaging 1.00
R7420:Gm4952 UTSW 19 12626901 missense probably damaging 1.00
R7702:Gm4952 UTSW 19 12627064 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGCCAGGTCACCAAGGCTTATATC -3'
(R):5'- CAAGAACTGTTTGTGGCGACAATCC -3'

Sequencing Primer
(F):5'- tgacaggaataagtgaggcataag -3'
(R):5'- GGCGACAATCCTATTGAAAGTACTC -3'
Posted On2013-07-11