Incidental Mutation 'PIT4486001:Pus10'
ID556112
Institutional Source Beutler Lab
Gene Symbol Pus10
Ensembl Gene ENSMUSG00000020280
Gene Namepseudouridylate synthase 10
SynonymsCcdc139, 4933435A13Rik, 2810013G11Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4486001 (G1)
Quality Score189.009
Status Not validated
Chromosome11
Chromosomal Location23665674-23732876 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 23712326 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020520] [ENSMUST00000058163] [ENSMUST00000109525]
Predicted Effect probably null
Transcript: ENSMUST00000020520
SMART Domains Protein: ENSMUSP00000020520
Gene: ENSMUSG00000020280

DomainStartEndE-ValueType
PDB:2V9K|A 1 527 N/A PDB
Predicted Effect probably null
Transcript: ENSMUST00000058163
SMART Domains Protein: ENSMUSP00000050395
Gene: ENSMUSG00000020280

DomainStartEndE-ValueType
PDB:2V9K|A 1 527 N/A PDB
Predicted Effect probably null
Transcript: ENSMUST00000109525
SMART Domains Protein: ENSMUSP00000105151
Gene: ENSMUSG00000020280

DomainStartEndE-ValueType
PDB:2V9K|A 1 527 N/A PDB
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.5%
  • 10x: 84.1%
  • 20x: 70.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pseudouridination, the isomerization of uridine to pseudouridine, is the most common posttranscriptional nucleotide modification found in RNA and is essential for biologic functions such as spliceosome biogenesis. Pseudouridylate synthases, such as PUS10, catalyze pseudouridination of structural RNAs, including transfer, ribosomal, and splicing RNAs. These enzymes also act as RNA chaperones, facilitating the correct folding and assembly of tRNAs (McCleverty et al., 2007 [PubMed 17900615]).[supplied by OMIM, May 2009]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T C 5: 145,044,104 S108P probably damaging Het
4930548H24Rik T A 5: 31,487,743 I280K probably damaging Het
4931408C20Rik G A 1: 26,685,329 P257S probably damaging Het
Abhd16b A T 2: 181,493,959 Q218L probably benign Het
Abhd3 T A 18: 10,645,233 I354F probably benign Het
Abt1 T C 13: 23,423,681 Y51C possibly damaging Het
Actl9 T A 17: 33,434,198 Y411N possibly damaging Het
Ano4 A G 10: 88,993,029 V516A probably damaging Het
Bptf A T 11: 107,054,788 S2542T probably damaging Het
Card11 C T 5: 140,876,408 V1045M probably damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cdh3 A G 8: 106,541,490 K386E possibly damaging Het
Cks1b C A 3: 89,416,314 Q49H probably damaging Het
Clpb A T 7: 101,663,932 D41V probably benign Het
Cyp3a11 A T 5: 145,860,492 M359K probably damaging Het
Cyp3a13 A T 5: 137,909,966 I207N probably benign Het
Dennd4c T A 4: 86,799,464 L566* probably null Het
Dhtkd1 A T 2: 5,899,995 D859E probably benign Het
Efcab6 T C 15: 83,973,313 D295G probably benign Het
Fcgbp A G 7: 28,075,273 T91A possibly damaging Het
Gm11569 GCAGCTGGGCCTGCAGCAGCTGGAAATGCAGCAGCTAGGACGGCAACA GCA 11: 99,798,665 probably benign Het
Gm884 A T 11: 103,618,201 H980Q unknown Het
Gsdma3 A G 11: 98,638,054 K454E unknown Het
Herc1 T A 9: 66,372,389 I193N probably damaging Het
Kdm5b T A 1: 134,628,685 L1370Q probably damaging Het
Map4 T G 9: 110,072,614 V965G probably damaging Het
Mkrn2os T C 6: 115,585,483 D173G probably benign Het
Ndfip2 A G 14: 105,294,866 D232G probably damaging Het
Nipal2 C T 15: 34,584,729 G231D probably damaging Het
Notch3 A T 17: 32,154,763 N490K probably damaging Het
Olfr150 T A 9: 39,737,239 C141* probably null Het
Olfr493 A G 7: 108,346,322 S220P possibly damaging Het
Prkar2a T C 9: 108,733,127 L185S probably damaging Het
Ptpn9 T G 9: 57,061,003 N542K probably damaging Het
Pyroxd2 A G 19: 42,740,389 S191P probably benign Het
Rab15 T A 12: 76,801,942 K122* probably null Het
Rara A G 11: 98,973,495 N416S possibly damaging Het
Rims2 T C 15: 39,476,520 V870A possibly damaging Het
Sec16a T C 2: 26,425,773 T293A Het
Slc26a3 G A 12: 31,470,950 D718N probably benign Het
Slc44a5 G A 3: 154,259,022 V520I possibly damaging Het
Tgfb2 A T 1: 186,690,727 Y142N probably benign Het
Tgfbi A T 13: 56,629,794 I364F probably damaging Het
Tmem144 A C 3: 79,826,867 D176E probably benign Het
Tns4 A T 11: 99,071,335 L612Q probably damaging Het
Toe1 A G 4: 116,806,495 L76S probably damaging Het
Trank1 T C 9: 111,390,107 F1971L probably damaging Het
Tsen54 G T 11: 115,822,596 V481F probably damaging Het
Uimc1 A G 13: 55,075,568 L297P probably damaging Het
Wnt8a T C 18: 34,547,583 Y334H probably damaging Het
Zfp281 A G 1: 136,627,003 D573G possibly damaging Het
Other mutations in Pus10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02260:Pus10 APN 11 23707548 nonsense probably null
IGL02304:Pus10 APN 11 23712275 missense probably damaging 1.00
IGL02466:Pus10 APN 11 23725574 missense probably damaging 0.99
IGL02967:Pus10 APN 11 23718602 missense probably damaging 1.00
IGL03233:Pus10 APN 11 23712241 missense probably damaging 1.00
IGL03300:Pus10 APN 11 23731368 utr 3 prime probably benign
PIT4677001:Pus10 UTSW 11 23720171 missense possibly damaging 0.88
R0166:Pus10 UTSW 11 23667358 missense probably damaging 1.00
R0440:Pus10 UTSW 11 23673331 unclassified probably benign
R0519:Pus10 UTSW 11 23711201 missense probably benign 0.02
R1583:Pus10 UTSW 11 23673239 missense probably damaging 0.96
R1714:Pus10 UTSW 11 23725542 missense probably damaging 1.00
R1941:Pus10 UTSW 11 23711198 missense possibly damaging 0.60
R3687:Pus10 UTSW 11 23667334 missense probably benign
R3688:Pus10 UTSW 11 23667334 missense probably benign
R3854:Pus10 UTSW 11 23703003 critical splice donor site probably null
R4064:Pus10 UTSW 11 23728983 missense probably damaging 1.00
R4127:Pus10 UTSW 11 23718654 critical splice donor site probably null
R4276:Pus10 UTSW 11 23706895 missense probably damaging 1.00
R4655:Pus10 UTSW 11 23672707 missense probably benign 0.02
R5302:Pus10 UTSW 11 23667416 critical splice donor site probably null
R5580:Pus10 UTSW 11 23672556 missense probably benign 0.16
R6196:Pus10 UTSW 11 23672638 missense probably benign 0.15
R6549:Pus10 UTSW 11 23729075 critical splice donor site probably null
R6722:Pus10 UTSW 11 23702975 missense possibly damaging 0.93
R6724:Pus10 UTSW 11 23729037 missense possibly damaging 0.78
X0064:Pus10 UTSW 11 23708743 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTCTTAGTTAAGGCCTGGGC -3'
(R):5'- TCTGAACTAGAATCCAGCATGGG -3'

Sequencing Primer
(F):5'- TATCCTAGCATTCAGAATAGCAAAC -3'
(R):5'- GCTGGAAGCCCTGTGAACATG -3'
Posted On2019-06-07